Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

H3K9me2 and H3K27me3 positive controls


  • Please log in to reply
3 replies to this topic

#1 Xenos

Xenos

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 17 March 2009 - 06:19 AM

Hi everyone,


I'm performing ChIP experiments on Tera-1 cells (human embryonic carcinoma cell line) followed by Real time-PCR. I found reliable positive controls for active histone modifications (H3K4me2, H3Ac,...) but didn't find good positive control genes for the repressive marks H3K9me2 and H3K27me3. Does anyone have an experience in control genes for those modifications in hEC/hES cells ?

Thanks a lot

#2 Clare

Clare

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 181 posts
1
Neutral

Posted 17 March 2009 - 09:23 AM

Hey there :)

We are not using hEC/hES cells but found Gsx2 a good control for H3K27me3 in human AML cells (and 'normal controls'). It's involved in brain development or something. You could give it a go? The primers:

forward: CCCGGAAACCGAGGGATAGA
reverse: GGCCGAGTGTTGCCCTCTAA

Hope this helps :(

Clare



Hi everyone,


I'm performing ChIP experiments on Tera-1 cells (human embryonic carcinoma cell line) followed by Real time-PCR. I found reliable positive controls for active histone modifications (H3K4me2, H3Ac,...) but didn't find good positive control genes for the repressive marks H3K9me2 and H3K27me3. Does anyone have an experience in control genes for those modifications in hEC/hES cells ?

Thanks a lot



#3 Xenos

Xenos

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 18 March 2009 - 04:14 AM

Hey there :)

We are not using hEC/hES cells but found Gsx2 a good control for H3K27me3 in human AML cells (and 'normal controls'). It's involved in brain development or something. You could give it a go? The primers:

forward: CCCGGAAACCGAGGGATAGA
reverse: GGCCGAGTGTTGCCCTCTAA

Hope this helps :D

Clare



Hi everyone,


I'm performing ChIP experiments on Tera-1 cells (human embryonic carcinoma cell line) followed by Real time-PCR. I found reliable positive controls for active histone modifications (H3K4me2, H3Ac,...) but didn't find good positive control genes for the repressive marks H3K9me2 and H3K27me3. Does anyone have an experience in control genes for those modifications in hEC/hES cells ?

Thanks a lot



Hi Clare,

Thanks for the kind advice. I will give it a try :D

#4 Clare

Clare

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 181 posts
1
Neutral

Posted 18 March 2009 - 04:41 AM

Let us know how you get on :D

Clare




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.