Hi,
please can anybody help me
for bad lucky, my gen (the sequence ) until now not identify from fungi, but identified from higher plant only. so, i used this sequence (C-DNA) from higher plant to design from it my primer ( gen in fungi is the same function and nam as from higher plant) so i used it.
**1- in the first i designed from conserved reigon but formed bad result and primer- dimer ( in sample brode band, in control thin band but the both at same size) may be primer-dimer,
**2- design as program by take part of sequence similar in all speacies of plant but result not good also, same band in control and sample as same size but when increase annealing disappeared in both although, Delta G -4 only.
** 3- then designed another primer as sequence of primer used in higher plant this is:
forwared: 5'- AACATAGATGGTGTAGAGGGT -3'
reverse : 5'- GATAGTTTCTATCGGCTGCAT -3'
HETERO-DIMER ANALYSIS
Primary Sequence
5'- AACATAGATGGTGTAGAGGGT -3'
Secondary Sequence
5'- GATAGTTTCTATCGGCTGCAT -3'
Maximum Delta G -37.96 kcal/mole
Delta G
-5.61 kcal/mole
Base Pairs
5
from this data i can said the % of formation of primer -dimer was very less.
**in higher plant must was the product size 420 Bp not (100-150 Bp) only. in the first : at RT-PCR (RNA) formed same band at same size in control but when increased the anneling the band disappeared from control but Continued to found in sample and i send my picture to see it. this is change in interpretation what is happening?
I used PCR reaction (from DNA) to confirm the result because i am afraid from this band may be primer- dimer only not original band on the basis of appearence with all primer used but with chang the case from (" appeared" & "disappeared") with increase annealing.
i found same band at same size in RCR- reaction in control & sample but this at low annealing (55 o C ) temperature. so, i can't know what this is means? rhight sequence or primer- dimer only.
sorry,sorry for elongation
saly4ever@hotmail.com
RT-PCR
Started by saly, Feb 26 2009 06:21 AM
1 reply to this topic













