Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

DNA sequencing analysis


  • Please log in to reply
1 reply to this topic

#1 zack

zack

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 27 January 2009 - 04:01 PM

hi admin and chatter,

i need help on dna sequencing analysis

i just got the result

this sequencing are taking at NCBI, code AF012789 for gen cyto B

ORIGIN
1 tttggctctc ttttaggact ctgcttaatt acacaaatcc tcacagggct atttcttgct
61 atacattaca catcagacat ttctaccgcc ttctcatccg tggcacacat ttgccgagac
121 gtaaactatg gatgactaat tcgtaacctc cacgccaacg gcgcctcatt tttctttatt
181 tgtatttatt tccacatcgg ccgaggccta tactacggct cctacctcta taaagagaca
241 tgaaatgtcg gcgtaatact actgctacta gtgatgatga cggcgttcgt agggtacgtt
301 ctaccc
//

this sequence are only 306bp

however last time i test for the same gen cyto B but using this primers

L14841 [5-AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA-3] (FORWORD)
and
H15149 [5-AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA-3] (REVERSE)

and the result is

> sequence 1 (L14841/FORWORD) are 334bp
AGCTCCTCACTGAGGACTCTGTTTAATCGCACAAATTGTCACAGGGCTATTCCTCGCAATACACTACACGTCTGACATTA
CCACCGCCTTCTCATCCGGAGCCCACATCTGGCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGA
GCCTCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG
AAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCAT
TCTGAGGGGCTGCA

> sequence 1 (H15149/REVERSE) are 347bp
GGCGTTATTTATACATATACCTACAAAGGTGGTTTTATAACTAGTAAGAGAAGAATTACCCCGATGTTTCATGTTTCTTT
ATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATGTGGAAATAAATGCAGATAAAGAAAAAAGAGGCTCCGTTGGCGT
GGAGGTTTCGGATTAGTCAACCGTAATTGACGTCTCGGCAGATGTGGGCTACGGATGAGAAGGCGGTGGTAATGTCAGAC
GTGTAGTGTATTGCGAGGAATAGGCCTGTGACAATTTGTGCGATTAAGCAGAGTCCCAGTAGGGAGCCAAAGTTTCATCA
TGCTGAGATGTTGGATGGAAGTTTTAA

> sequence 2 (L14841/FORWORD) are 239bp only
AGGAAAAGAGGAAATTCTGTAGGGGGGCACAAATTGACCAGGCCTATTCCTCGCAATACACTACACGTCTGACATTACCA
CCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCC
TCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAA
CATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCATTCT
GAGGGGCTG

> sequence 2 (H15149/REVERSE) are 377bp

ACTCTACATCACAGGAGTTTTTGTAAGAACTATTTTAGAGAAGAATTACCCCGATGTTTCATGTTTCTTTATATAGGTAG
GAGCCGTAGTATAGTCCTCGTCCGATGTGAAAATAAATGCAAATAAAGAAAAAAGAGGCTCCGTTGGCGTGGAGGTTTCG
GATTAGTCAACCGTAATTGACGTCTCGGCAGATGGGGGCTACGGATGAGAAGGCGGTGGTAATGTCAGACGTGTAGTGTA
TTGCGAGGAATAGGCCTGTGACAATTTGTGCGATTAAGCAGAGTCCCAGTAGGGAGCCAAAGTTTCATCATGCTGAGATG
TTGGATGGAAGTTTTAA

> sequence 3 (L14841/FORWORD) are 334 bp

ACAAACTGTATAATCTGTTAGGGGCTCAAATTTACACAGGCCTATTCCTCGCAATACACTACACGTCTGACATTACCACC
GCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTC
TTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACA
TCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCATTCTGA
GGGGCTGCAGTTAA

> sequence 3 (H15149/REVERSE) are 347bp
GNNNNGGGATAACTCCTCTCCTGCTGGGATGGTGTAAGAACTATTTTAGAGAAGAATTACCCCGATGTTTCATGTTTCTT
T
ATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATGTGGAAATAAATGCAGATAAAGAAAAAAGAGGCTCCGTTGGCGT
GGAGGTTTCGGATTAGTCAACCGTAATTGACGTCTCGGCAGATGTGGGCTACGGATGAGAAGGCGGTGGTAATGTCAGAC
GTGTAGTGTATTGCGAGGAATAGGCCTGTGACAATTTGTGCGATTAAGCAGAGTCCCAGTAGGGAGCCAAAGTTTCATCA
TGCTGAGATGTTGGATGGAATTTTTA


what's is the problem, all the basepair not the same ... izzit the sequence should be the same as in GENEBANK (NCBI)

#2 pcrboy

pcrboy

    member

  • Active Members
  • Pip
  • 18 posts
0
Neutral

Posted 28 January 2009 - 06:46 PM

i suggest blasting your unknown sequence. if its totally unspecific even to he chromosome you're looking at, it can likely be contamination.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.