Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

DNA sequencing analysis


  • Please log in to reply
11 replies to this topic

#1 zack

zack

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 27 January 2009 - 03:44 PM

hi admin and chatter,

i need help on dna sequencing analysis

i just got the result

this sequencing are taking at NCBI, code AF012789 for gen cyto B

ORIGIN
1 tttggctctc ttttaggact ctgcttaatt acacaaatcc tcacagggct atttcttgct
61 atacattaca catcagacat ttctaccgcc ttctcatccg tggcacacat ttgccgagac
121 gtaaactatg gatgactaat tcgtaacctc cacgccaacg gcgcctcatt tttctttatt
181 tgtatttatt tccacatcgg ccgaggccta tactacggct cctacctcta taaagagaca
241 tgaaatgtcg gcgtaatact actgctacta gtgatgatga cggcgttcgt agggtacgtt
301 ctaccc
//

this sequence are only 306bp

however last time i test for the same gen cyto B but using this primers

L14841 [5-AAAAAGCTTCCATCCAACATCTCAGCATGATGAAA-3] (FORWORD)
and
H15149 [5-AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA-3] (REVERSE)

and the result is

> sequence 1 (L14841/FORWORD) are 334bp
AGCTCCTCACTGAGGACTCTGTTTAATCGCACAAATTGTCACAGGGCTATTCCTCGCAATACACTACACGTCTGACATTA
CCACCGCCTTCTCATCCGGAGCCCACATCTGGCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGA
GCCTCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG
AAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCAT
TCTGAGGGGCTGCA

> sequence 1 (H15149/REVERSE) are 347bp
GGCGTTATTTATACATATACCTACAAAGGTGGTTTTATAACTAGTAAGAGAAGAATTACCCCGATGTTTCATGTTTCTTT
ATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATGTGGAAATAAATGCAGATAAAGAAAAAAGAGGCTCCGTTGGCGT
GGAGGTTTCGGATTAGTCAACCGTAATTGACGTCTCGGCAGATGTGGGCTACGGATGAGAAGGCGGTGGTAATGTCAGAC
GTGTAGTGTATTGCGAGGAATAGGCCTGTGACAATTTGTGCGATTAAGCAGAGTCCCAGTAGGGAGCCAAAGTTTCATCA
TGCTGAGATGTTGGATGGAAGTTTTAA

> sequence 2 (L14841/FORWORD) are 239bp only
AGGAAAAGAGGAAATTCTGTAGGGGGGCACAAATTGACCAGGCCTATTCCTCGCAATACACTACACGTCTGACATTACCA
CCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCC
TCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAA
CATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCATTCT
GAGGGGCTG

> sequence 2 (H15149/REVERSE) are 377bp

ACTCTACATCACAGGAGTTTTTGTAAGAACTATTTTAGAGAAGAATTACCCCGATGTTTCATGTTTCTTTATATAGGTAG
GAGCCGTAGTATAGTCCTCGTCCGATGTGAAAATAAATGCAAATAAAGAAAAAAGAGGCTCCGTTGGCGTGGAGGTTTCG
GATTAGTCAACCGTAATTGACGTCTCGGCAGATGGGGGCTACGGATGAGAAGGCGGTGGTAATGTCAGACGTGTAGTGTA
TTGCGAGGAATAGGCCTGTGACAATTTGTGCGATTAAGCAGAGTCCCAGTAGGGAGCCAAAGTTTCATCATGCTGAGATG
TTGGATGGAAGTTTTAA

> sequence 3 (L14841/FORWORD) are 334 bp

ACAAACTGTATAATCTGTTAGGGGCTCAAATTTACACAGGCCTATTCCTCGCAATACACTACACGTCTGACATTACCACC
GCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTC
TTTCTTCTTTATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACA
TCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCATTCTGA
GGGGCTGCAGTTAA

> sequence 3 (H15149/REVERSE) are 347bp
GNNNNGGGATAACTCCTCTCCTGCTGGGATGGTGTAAGAACTATTTTAGAGAAGAATTACCCCGATGTTTCATGTTTCTT
T
ATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATGTGGAAATAAATGCAGATAAAGAAAAAAGAGGCTCCGTTGGCGT
GGAGGTTTCGGATTAGTCAACCGTAATTGACGTCTCGGCAGATGTGGGCTACGGATGAGAAGGCGGTGGTAATGTCAGAC
GTGTAGTGTATTGCGAGGAATAGGCCTGTGACAATTTGTGCGATTAAGCAGAGTCCCAGTAGGGAGCCAAAGTTTCATCA
TGCTGAGATGTTGGATGGAATTTTTA


what's is the problem, all the basepair not the same ... izzit the sequence should be the same as in GENEBANK (NCBI)

#2 mdfenko

mdfenko

    an elder

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 2,612 posts
118
Excellent

Posted 28 January 2009 - 08:07 AM

sequencers make mistakes. you need to get a consensus sequence and compare to that from ncbi.

usually the differences are caused by noise at the beginning and end of the sequence, depending on reaction strength.

keep in mind that sequence data does not usually start at the end of the primer. depending on how you clean the reaction you can start from 5-20 bases after the primer.

Edited by mdfenko, 28 January 2009 - 08:08 AM.

talent does what it can
genius does what it must
i do what i get paid to do

#3 merlav

merlav

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 47 posts
0
Neutral

Posted 29 January 2009 - 04:01 AM

You need a concensus sequence and an aligment tool (ie Omiga, clustal x).
Science without religion is lame, religion without science is blind.
Albert Einstein

I am among those who think that science has great beauty. A scientist in his laboratory is not only a technician: he is also a child placed before natural phenomena which impress him like a fairy tale.
Marie Curie

#4 zack

zack

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 29 January 2009 - 10:49 AM

Posted Image

here my concensus sequence tree, what the conclusion from that's tree?

#5 hanming86

hanming86

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 156 posts
2
Neutral

Posted 04 February 2009 - 03:18 AM

Posted Image

here my concensus sequence tree, what the conclusion from that's tree?


I Know you're from malaysia .

Maybe your DNA template is dirty thus causing subsequent problem either in sequencing or the running of sequencing product.

1. What university are you from?

2. What equipment did you use to check your DNA purity? ( gel can't tell anything about purity , perhaps maybe etoH contamination)

3. And attach your format in .abi format, 1st base is notorious for giving "fake" sequence in the .seq format. A lousy sequence could still generate " good" .seq file if the base calling software is not stringent enough.

4. what's the first base remark on you seq?

5. Your seq might not be exactly the same as the seq obtained from gen bank unless it's from the exact same source.remember evolution and natural selection.

cheers'

Ming
UTM Skudai
Lab + Coffee + Music = Bliss

#6 zack

zack

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 04 February 2009 - 05:16 AM

Posted Image

here my concensus sequence tree, what the conclusion from that's tree?


I Know you're from malaysia .

Maybe your DNA template is dirty thus causing subsequent problem either in sequencing or the running of sequencing product.

1. What university are you from?

2. What equipment did you use to check your DNA purity? ( gel can't tell anything about purity , perhaps maybe etoH contamination)

3. And attach your format in .abi format, 1st base is notorious for giving "fake" sequence in the .seq format. A lousy sequence could still generate " good" .seq file if the base calling software is not stringent enough.

4. what's the first base remark on you seq?

5. Your seq might not be exactly the same as the seq obtained from gen bank unless it's from the exact same source.remember evolution and natural selection.

cheers'

Ming
UTM Skudai


hi Ming. yes u are right.. i;m from malaysia. and still study at UPM, actually i'm not from molecular background. but i still learning more bout it. the result that;s i send to first base ... i dont know what the conclusion becoz the sample not in the same bp size.

2. i'm using hitachi U2910

3. u can download the attachment

4. Posted Image

it's my pleasure if u can give some opinion and advice on the .abi format

thank you ming

Attached Files



#7 hanming86

hanming86

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 156 posts
2
Neutral

Posted 04 February 2009 - 09:03 PM

Posted Image

here my concensus sequence tree, what the conclusion from that's tree?


I Know you're from malaysia .

Maybe your DNA template is dirty thus causing subsequent problem either in sequencing or the running of sequencing product.

1. What university are you from?

2. What equipment did you use to check your DNA purity? ( gel can't tell anything about purity , perhaps maybe etoH contamination)

3. And attach your format in .abi format, 1st base is notorious for giving "fake" sequence in the .seq format. A lousy sequence could still generate " good" .seq file if the base calling software is not stringent enough.

4. what's the first base remark on you seq?

5. Your seq might not be exactly the same as the seq obtained from gen bank unless it's from the exact same source.remember evolution and natural selection.

cheers'

Ming
UTM Skudai


hi Ming. yes u are right.. i;m from malaysia. and still study at UPM, actually i'm not from molecular background. but i still learning more bout it. the result that;s i send to first base ... i dont know what the conclusion becoz the sample not in the same bp size.

2. i'm using hitachi U2910

3. u can download the attachment

4. Posted Image

it's my pleasure if u can give some opinion and advice on the .abi format

thank you ming


Hey i think your seq can align perfectly well . There seems to be no problem . extra seq flanking the PCR product is expected in sequencing .

I didn't have the time actually to look if the primer seq is within your PCR or not. i need to go eat lunch first now.

And the seq difference from NCBI should be expected if your source is from other individual.

more details on your work would help

k thanks

cheers
-ming
Lab + Coffee + Music = Bliss

#8 molgen

molgen

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 167 posts
0
Neutral

Posted 12 February 2009 - 09:10 AM

If you run the sequences in ClustalW (or any other alignment tool) you'll see how close the sequences are.
It is very clear that the odd numbers are one type and that the even ones are the other type.

seq4 -----------ACTCTACATCACAGGAGTTTTTGTAAGAACTATTTTAGAGAAGAATTAC 49
seq6 GNNNNGGGATAACTCCTCTCCTGCTGGGATGGTGTAAGAACTATTTTAGAGAAGAATTAC 60
seq2 GGCGTTATTTATACATATACCTACAAAGGTGGTTTTATAACTAGTA-AGAGAAGAATTAC 59
seq3 -------AGGAAAAGAGGAAATTCTGTAGGGGGGCACAAATTGAC-CAG-GCCTATTCCT 51
seq5 ---------ACAAACTGTATAATCTGTTAGGGG-CTCAAATTTACACAG-GCCTATTCCT 49
seq1 -----AGCTCCTCACTGAGGACTCTGTTTAATCGCACAAATTGTCACAG-GGCTATTCCT 54
** * ** * * *

seq4 CCCGATGT--TTCATGTTTCTTTATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATG 107
seq6 CCCGATGT--TTCATGTTTCTTTATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATG 118
seq2 CCCGATGT--TTCATGTTTCTTTATATAGGTAGGAGCCGTAGTATAGTCCTCGTCCGATG 117
seq3 CGCAATACACTACACGTCTGACATTACCACCGCCTTCTCATCCGTAGCCCACATCTGCCG 111
seq5 CGCAATACACTACACGTCTGACATTACCACCGCCTTCTCATCCGTAGCCCACATCTGCCG 109
seq1 CGCAATACACTACACGTCTGACATTACCACCGCCTTCTCATCCGGAGCCCACATCTGGCG 114
* * ** * ** ** * ** * ** ** * ** * *

seq4 TGAAAATAAATGCAAATAAAGAAAAAAGAGGCTCCGTTGGCGTGGAGGTTTCGGATTAGT 167
seq6 TGGAAATAAATGCAGATAAAGAAAAAAGAGGCTCCGTTGGCGTGGAGGTTTCGGATTAGT 178
seq2 TGGAAATAAATGCAGATAAAGAAAAAAGAGGCTCCGTTGGCGTGGAGGTTTCGGATTAGT 177
seq3 AGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTCTTCTT 171
seq5 AGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTCTTCTT 169
seq1 AGACGTCAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTCTTCTT 174
* ** * * * * ** * **** **** * ** *

seq4 CAACCGTAATTGACGTCTCGGCAGATGGGGGCTACGGATGAGAAGGCGGTGGTAATGTCA 227
seq6 CAACCGTAATTGACGTCTCGGCAGATGTGGGCTACGGATGAGAAGGCGGTGGTAATGTCA 238
seq2 CAACCGTAATTGACGTCTCGGCAGATGTGGGCTACGGATGAGAAGGCGGTGGTAATGTCA 237
seq3 TATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGA 231
seq5 TATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGA 229
seq1 TATCTGCATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGA 234
* * * * ** * * * ** * ** *** * ** *

seq4 GACGTGTAGTGTATTGCGAGGAATAGGCCT----GTGACAATTTGTGCGATT--AAGCAG 281
seq6 GACGTGTAGTGTATTGCGAGGAATAGGCCT----GTGACAATTTGTGCGATT--AAGCAG 292
seq2 GACGTGTAGTGTATTGCGAGGAATAGGCCT----GTGACAATTTGTGCGATT--AAGCAG 291
seq3 AACATGAAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTA 291
seq5 AACATGAAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTA 289
seq1 AACATGAAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGTTA 294
** ** * * * * * *** ** * *** ** ** * *

seq4 AGTCCCAGTAGGGAGCCAAAGTTTCATCATGCTGAGATGTTGGATGGAAGTTTTAA 337
seq6 AGTCCCAGTAGGGAGCCAAAGTTTCATCATGCTGAGATGTTGGATGGAATTTTTA- 347
seq2 AGTCCCAGTAGGGAGCCAAAGTTTCATCATGCTGAGATGTTGGATGGAAGTTTTAA 347
seq3 TGTATTACCCTGAGGACAAA----TATCATTCTGAGGGGCTG-------------- 329
seq5 TGTATTACCCTGAGGACAAA----TATCATTCTGAGGGGCTGCAGTTAA------- 334
seq1 TGTATTACCCTGAGGACAAA----TATCATTCTGAGGGGCTGCA------------ 334
** * * * **** ***** ***** * **

Edited by molgen, 12 February 2009 - 09:14 AM.


#9 molgen

molgen

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 167 posts
0
Neutral

Posted 12 February 2009 - 09:11 AM

If you Align two sequences (NCBI) an odd number and an even number you'll see that they're the same sequence but frum opiset sides!!!

Length=347

Score = 483 bits (261), Expect = 4e-141
Identities = 288/300 (96%), Gaps = 5/300 (1%)
Strand=Plus/Minus <--

Query 2 GCT-CCTCACTGAGGACTCTGTTTAATCGCACAAATTGTCACAGGGCTATTCCTCGCAAT 60

Sbjct 307 GCTCCCT-ACTG-GGACTCTGCTTAATCGCACAAATTGTCACAGGCCTATTCCTCGCAAT 250


Query 61 ACACTACACGTCTGACATTACCACCGCCTTCTCATCCGGAGCCCACATCTGGCGAGACGT 120

Sbjct 249 ACACTACACGTCTGACATTACCACCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGT 190


Query 121 CAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTCTTCTTTATCTG 180

Sbjct 189 CAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTTTTCTTTATCTG 130


Query 181 CATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG 240

Sbjct 129 CATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG 70


Query 241 AAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGT-TATGTAT 299

Sbjct 69 AAACATCGGGGTAATTCTTCTCTTACTAGTTATAA-AACCACCTTTGTAGGTATATGTAT 11

Edited by molgen, 12 February 2009 - 09:18 AM.


#10 zack

zack

    member

  • Active Members
  • Pip
  • 21 posts
0
Neutral

Posted 12 February 2009 - 12:57 PM

If you Align two sequences (NCBI) an odd number and an even number you'll see that they're the same sequence but frum opiset sides!!!

Length=347

Score = 483 bits (261), Expect = 4e-141
Identities = 288/300 (96%), Gaps = 5/300 (1%)
Strand=Plus/Minus <--

Query 2 GCT-CCTCACTGAGGACTCTGTTTAATCGCACAAATTGTCACAGGGCTATTCCTCGCAAT 60

Sbjct 307 GCTCCCT-ACTG-GGACTCTGCTTAATCGCACAAATTGTCACAGGCCTATTCCTCGCAAT 250


Query 61 ACACTACACGTCTGACATTACCACCGCCTTCTCATCCGGAGCCCACATCTGGCGAGACGT 120

Sbjct 249 ACACTACACGTCTGACATTACCACCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGT 190


Query 121 CAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTCTTCTTTATCTG 180

Sbjct 189 CAATTACGGTTGACTAATCCGAAACCTCCACGCCAACGGAGCCTCTTTTTTCTTTATCTG 130


Query 181 CATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG 240

Sbjct 129 CATTTATTTCCACATCGGACGAGGACTATACTACGGCTCCTACCTATATAAAGAAACATG 70


Query 241 AAACATCGGGGTAATTCTTCTCCTACTAGTTATAATAACCGCCTTTGTAGGT-TATGTAT 299

Sbjct 69 AAACATCGGGGTAATTCTTCTCTTACTAGTTATAA-AACCACCTTTGTAGGTATATGTAT 11


what that;s mean.. simple explanation pls

Edited by zack, 12 February 2009 - 12:57 PM.


#11 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 930 posts
15
Good

Posted 12 February 2009 - 08:14 PM

Put all sequences in the same direction by reverse complementing the reverse sequences, and your alignment looks like this:

CLUSTAL 2.0.10 multiple sequence alignment


seq1			---------------------------------------AGCTCCTCACTGAGGACTCTG 21
seq1r		   TTAAAACTTCCATCCAACATCTCAGCATGATGAAACTTTGGCTCCCTACTGGG-ACTCTG 59
seq2			-----------------------------------------AGGAAAAGAGGAAATTCTG 19
seq2r		   TTAAAACTTCCATCCAACATCTCAGCATGATGAAACTTTGGCTCCCTACTGGG-ACTCTG 59
seq3			-------------------------------------------ACAAACTGTATAATCTG 17
seq3r		   -TAAAAATTCCATCCAACATCTCAGCATGATGAAACTTTGGCTCCCTACTGGG-ACTCTG 58
															   *  *   * ****

seq1			TTTAATCGCACAAATTGTCACAGGGCTATTCCTCGCAATACACTACACGTCTGACATTAC 81
seq1r		   CTTAATCGCACAAATTGTCACAGGCCTATTCCTCGCAATACACTACACGTCTGACATTAC 119
seq2			TAGGGGGGCACAAATTGAC-CAGGCCTATTCCTCGCAATACACTACACGTCTGACATTAC 78
seq2r		   CTTAATCGCACAAATTGTCACAGGCCTATTCCTCGCAATACACTACACGTCTGACATTAC 119
seq3			TTAGGGG-CTCAAATTTACACAGGCCTATTCCTCGCAATACACTACACGTCTGACATTAC 76
seq3r		   CTTAATCGCACAAATTGTCACAGGCCTATTCCTCGCAATACACTACACGTCTGACATTAC 118
						* ******  * **** ***********************************

seq1			CACCGCCTTCTCATCCGGAGCCCACATCTGGCGAGACGTCAATTACGGTTGACTAATCCG 141
seq1r		   CACCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCG 179
seq2			CACCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCG 138
seq2r		   CACCGCCTTCTCATCCGTAGCCCCCATCTGCCGAGACGTCAATTACGGTTGACTAATCCG 179
seq3			CACCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCG 136
seq3r		   CACCGCCTTCTCATCCGTAGCCCACATCTGCCGAGACGTCAATTACGGTTGACTAATCCG 178
				***************** ***** ****** *****************************

seq1			AAACCTCCACGCCAACGGAGCCTCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACG 201
seq1r		   AAACCTCCACGCCAACGGAGCCTCTTTTTTCTTTATCTGCATTTATTTCCACATCGGACG 239
seq2			AAACCTCCACGCCAACGGAGCCTCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACG 198
seq2r		   AAACCTCCACGCCAACGGAGCCTCTTTTTTCTTTATTTGCATTTATTTTCACATCGGACG 239
seq3			AAACCTCCACGCCAACGGAGCCTCTTTCTTCTTTATCTGCATTTATTTCCACATCGGACG 196
seq3r		   AAACCTCCACGCCAACGGAGCCTCTTTTTTCTTTATCTGCATTTATTTCCACATCGGACG 238
				*************************** ******** *********** ***********

seq1			AGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACATCGGGGTAATTCTTCT 261
seq1r		   AGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACATCGGGGTAATTCTTCT 299
seq2			AGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACATCGGGGTAATTCTTCT 258
seq2r		   AGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACATCGGGGTAATTCTTCT 299
seq3			AGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACATCGGGGTAATTCTTCT 256
seq3r		   AGGACTATACTACGGCTCCTACCTATATAAAGAAACATGAAACATCGGGGTAATTCTTCT 298
				************************************************************

seq1			CCTAC-TAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCAT 320
seq1r		   CTTAC-TAGTTATAAAA-CCACCTTTGTAGGTATATGTATAAATAACGCC---------- 347
seq2			CCTAC-TAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCAT 317
seq2r		   CTAAAATAGTTCTTACA-AAAACTCCTGTGATGTAGAGT--------------------- 337
seq3			CCTAC-TAGTTATAATAACCGCCTTTGTAGGTTATGTATTACCCTGAGGACAAATATCAT 315
seq3r		   CTAAAATAGTTCTTACA-CCATCCCAGCAGGAGAGGAGTTATCCCNNNNC---------- 347
				*  *  ***** * * *	 *	  *							  

seq1			TCTGAGGGGCTGCA----- 334
seq1r		   -------------------
seq2			TCTGAGGGGCTG------- 329
seq2r		   -------------------
seq3			TCTGAGGGGCTGCAGTTAA 334
seq3r		   -------------------

Pretty good agreement -- some minor base calling and end trimming, and you've got your sequence...

#12 molgen

molgen

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 167 posts
0
Neutral

Posted 15 February 2009 - 07:05 AM

what that;s mean.. simple explanation pls




Zack,
What this means is that you ether did:
T/A clonilg and half went in as 5' to 3' and the other half went in the other way (3' to 5').
Or you sequenced every thing from both sides.

In any case, you have the same sequence every time.

Edited by molgen, 15 February 2009 - 09:16 AM.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.