4 replies to this topic

[klahar]

Dear all!

Could anyone give me advice about how to ordering good primers for the attached sequence. I plan to do bisulfitesequencing and need good primers. I tried Bisearch both using the unconverted and the converted sequence as source but I'm not sure if I got any good result. Maybe I should design the primers manually? I would like to sequence the whole region but this may not be either possible or a good idea? Suggestions? Should I divide the sequence into several overlapping regions when sequencing, and if how to plan it, it seems as a difficult task.

Also I've heard that nested PCR give a better result than ordinary PCR, is this true? In that case I also would like to ask anyone in more detail how you plan nested PCR before ordering primers.

[pcrman]

Hi Klahar,

Your seqence contains a ver long CpG island with very high density of GC. because of this, it's hard to design BSP primers. However you can try the following:

1) Design primers which amplify the whole CpG island (because there are only ideal priming locations outside the cpg island). Some people have amplified >1 Kb region without problem. I have designed primers with long amplicon on your seqeunce. Here are the primers
Primer picking results for bisulfite sequencing (or restriction) PCR

   
   Primer            Start Size  Tm      GC%   'C's  Sequence
1  Left  primer       302   25   58.57   76.00   7  GGTAGGGAGATAGGTTTAGTAGGGT
   Right primer      1254   25   58.63   76.00  11  CTAAACTAAAACCCCAAAAAAACAC
   Product size: 953, Tm: 78.9, CpGs in product: 144

2  Left  primer       299   26   58.04   65.38   6  AAAGGTAGGGAGATAGGTTTAGTAGG
   Right primer      1254   25   58.63   76.00  11  CTAAACTAAAACCCCAAAAAAACAC
   Product size: 956, Tm: 78.8, CpGs in product: 144

3  Left  primer       182   25   59.04   56.00   4  TTATAATTGGGTGAAGGAGTAGAGG
   Right primer      1254   25   58.63   76.00  11  CTAAACTAAAACCCCAAAAAAACAC
   Product size: 1073, Tm: 78.8, CpGs in product: 147

4  Left  primer       181   25   57.19   56.00   5  TTTATAATTGGGTGAAGGAGTAGAG
   Right primer      1254   25   58.63   76.00  11  CTAAACTAAAACCCCAAAAAAACAC
   Product size: 1074, Tm: 78.8, CpGs in product: 147

5  Left  primer       180   26   58.37   53.85   5  TTTTATAATTGGGTGAAGGAGTAGAG
   Right primer      1254   25   58.63   76.00  11  CTAAACTAAAACCCCAAAAAAACAC
   Product size: 1075, Tm: 78.8, CpGs in product: 147

Here is the picture of primers on your seqence.
 1111450297.png (7.69K)
Number of downloads: 12

2) If this won't work because of very long amplicon, you can then try Bisearch to design degnerate primers on cpg sites.

Edited by pcrman, 21 March 2005 - 04:24 PM.

[klahar]

Thanks a lot pcrman!

I will order one of these primer pairs and check how it works.
Do you have any advice about PCR-conditions or special Taq-polymerase especially for this kind of PCR.

I suppose it will be difficult to plan a nested PCR with internal primers inside the CpG-island, because of high Tm compared to the flanking primers, but if nothing else works I will try to design degenerate primers from Bisearch.

[pcrman]

Regarding nested PCR, you don't need to design another pair of primers. You can just run two rounds of PCR using the same primers with the first round run 40 cycles, the 2nd 25-30 cycles. After the first round, you may not see any visible band but that's OK and just go ahead with the 2nd PCR using 0.5-10 ul product as the template.

I strongly recommend Sigma's JumpStart RedTaq polymerase which makes a huge difference.

Use down stream primer for sequencing and also design 3-4 internal antisense primers to seqence the whole region.

[methylnick]

 primer_design.doc (25K)
Number of downloads: 6Hi Khlar,

here's my two cents worth. Although people have in the past amplified such a large region sucessfully. I have been taught not to be too greedy and maybe design two sets of primers.

Attached is your sequence with the primer locations that I have chosen and the sequences you could order. I have also calculated the Tm using perlprimer, my colleague wrote the program and it has the most accurate Tm algorthim available to date.

You are looking at a CpG island, and it would be safe to say of the CG's assayed with my primer set, you can extend to the whole island, although to be absolutely sure, you will have to select more primer sets.

I am not familiar with all the programs available for such primer design, I have been stung using a particular program only to find out the primers chosen were not optimal.

Good luck with it and let us know how you go!!!

Nick

Edited by methylnick, 22 March 2005 - 02:30 PM.