Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo

internal standard for small RNA


  • Please log in to reply
3 replies to this topic

#1 Tomo

Tomo

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 07 February 2005 - 04:36 AM

Hi, there,

We've just started miRNA expression analysis with Northern blot, and are still new for this field.
I am wondering if anyone kindly provide the information about the probes to detect the internal controls for small RNA such as 5S rRNA, U6 snRNA and tRNAs. The organisms we are working are mouse, rat and human.
Thank you very much for your help.

Tomo

#2 fred_33

fred_33

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 288 posts
0
Neutral

Posted 07 February 2005 - 04:51 AM

hi
try the probe of paul et al. Mol. Therap. Feb 2003
CACGAATTTGCGTGTCATCCTTGCGCAGGGGCC
:D
fred

#3 Tomo

Tomo

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 21 February 2005 - 07:21 PM

Thank you.
It's great help for us.

Tomo

#4 fred_33

fred_33

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 288 posts
0
Neutral

Posted 22 February 2005 - 02:39 AM

hi
i realize i didn't tell the community it's an U6 probe.
sorry :)




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.