Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

* * * * * 2 votes

How to find promoter sequence for methylation study


  • Please log in to reply
8 replies to this topic

#1 eagertolearn

eagertolearn

    member

  • Members
  • Pip
  • 4 posts
1
Neutral

Posted 03 February 2005 - 05:22 PM

This is the URL to my gene of interest.

http://www.ncbi.nlm....nk&val=14579058

I am trying to estimate the promoter region of this gene so that I can do Meth specific PCR on the promoter..the promoter region of this gene has not been positively identified..but the exon information is known. I am new to this field.. Could anyone please help me out, preferably using step by step directions if possible.

Thank you!!!

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,031 posts
46
Excellent

Posted 03 February 2005 - 06:39 PM

Here is what I did to find the 5' flanking sequence of your gene: [this post has been updated, see several posts below]

1. I searched NCBI nucleotide database using "gene name + promoter" or "gene name + flanking" and got no hit.
2. Then, I went to ensembl.org and found the gene, clicked "View genomic sequence for this gene with exons highlighted", and asked it to export 1kb 5' sequence.
3. I copied the 5' sequence and fed to methprimer to predict CpG islands. Luckily, there is a CpG island close to the first exon (see fig below), which means the 5' sequence is likely the promoter of the gene.
4. I pasted the sequence back to NCBI blastn program to see if it matches  experimentally identified promoter sequences that I might have missed by gene name text search. In this case, I didn't find any, which means the promoter of this gene has not been characterized yet. You can safely assume the sequence I got is the 5' regulatroy sequence and go ahead with methylation mapping of the identified CpG island.

Hope that's helps.

5' Flanking sequence (red is exon):

GAAGGCCAAGTACCCCAACTCTCCCCGACGCTGCTGAGCCCTTCCCTCCCCTAATCTGAG
AAGTCAGCCTCTTGGCTCCTCAGGCCACCATTTAGGCCTGACTGGGGTAAGAAATGTCGC
TCCACTTTACAGAGGTAGCTGTGGTGTTGAAACACTGGACTTGGATATGGGGTGCTGGGA
TCGATTCCTAGCTTTACCACTAACTAGCTGTGTGGCCTTGAGTAAATCCCGTTACCTCTC
TGAGCCTCGGTTACCCTGTCTGTAAAAAGGGAGGTGAGAATACCTACCTCACGGAACTGT
TGGGAGGCTCAGATGAGATGCTATATGTGAAAACATTCTGTAAGCTTCGTACAAATGTGA
AGTATTAATATTATCGCAGTATTATTGTTGTTATTATTATTGTTATTATTAACAATCTTG
GGTGGGTAGTAGGAGAGCAAAAAGTATGAATGGGATGGAGCTAAGAAGTCTGAATACTTA
ATGAAATGGACTTTTTGGAAAGAAATCAGATGAAGGCATAAAATTTAGTTCTTAGCTCTT
GAACAGAAGCCTAAAATTCCTGGTTCTCTCAGGGCTTCGCCTTCAAGGGTTCTGGAGGAG
GGAAGGGTCTGCAGGTTCCATGGGTGACAGCCTGAGATCTGTCCCTTCAACGGGCTGGGC
TGGGTATGTGCCTACCGATGACAATGTGTAAATAAATGCGTGTTCACACCCACAGCTGGC
TCCGTTACTCTCCTGAGCTGGGGGTGGGGGGATCGGGGCCGGCTTCTCCCCTTGCACGCC
GTGGGGAGATGGCCGCGGACGAAGGGCACCGTCTGCAAAGCACTGAACCATCAGGGCCTT
CCCTGCAGGCCGAAGGCCTGCGCGAATGTCGGCCAGTTACTATGGAGACCGGCCCGCGGT
ATCCCAGCATGCCTCGGGACCAAACTGTCCAACTGTGAGCATCCCCGACGGTCGCCTCCT
GATGACGCACACGGAAGCACCGATAGGCTCTGCCTCCCGAAGAAAAGGGAGCCGCGCAGC


CpG island prediction (blue) and BSP primer design
bsp.png

#3 eagertolearn

eagertolearn

    member

  • Members
  • Pip
  • 4 posts
1
Neutral

Posted 03 February 2005 - 08:42 PM

Thank you very much!! I have one more query..Is there a way to do this using the Entrez gateway? The problem is my boss trusts ncbi more than anything else..thank you very much again!

#4 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,031 posts
46
Excellent

Posted 03 February 2005 - 11:40 PM

You can just blast NCBI database using the sequence I got from ensembl. I am sure this sequence and the mRNA sequence will align to the same genomic sequence. Actually all genome databases (ensembl, UCSC and NCBI) use the same data and assembly but present the data differently. ensembl provides the best genome browser.

#5 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,031 posts
46
Excellent

Posted 05 August 2009 - 07:43 PM

Many people have problem identifying or predicting the promoter sequence of a gene, or don't know how to get the actual sequence for analysis such as primer design, transcription factor binding site search, etc. Here I provide ways how I do these things.

1. How to find and retrieve promoter sequences from genome databases

Promoter sequences are usually the sequence immediately upstream the transcription start site (TSS) or first exon. If we know the TSS of a gene, we will know with confidence where the promoter is even without experimental characterization. For many organisms, such as as human, mouse, the genome is well annotated and TSS well defined. Thus promoter sequence retrieval is an easy task. There are three major genome browsers: NCBI, Ensembl and UCSC. For our purpose, Ensembl provides the most convenient interface. Here is an example:

  • go to ensembl website: http://www.ensembl.org/index.html
  • choose an organism such as human http://www.ensembl.o...iens/Info/Index
  • Search your gene such as BRCA2 http://www.ensembl.o...ns;idx=;q=brca2
  • Click the right hit on the search result page and it will bring you to the gene summary page. For example the link to BRCA2 gene is http://www.ensembl.o...ns;idx=;q=brca2
  •   On the left, under "Gene Summary", click "Sequence", the sequence of the gene including 5' flanking, exons, introns and flanking region will be displayed.
  • The exons are high lighted in pink background and red text, the sequence in front of the first exon is the promoter sequence.
  • By default, 600 bp 5'-flanking sequence (promoter) is displayed. If you want to get more, click "Configure this page" in the lower left column, a popup window opens allowing to input the size of 5' Flanking sequence (upstream). You can put for example "1000" and then save the configuration.
  • Sometimes there are discrepancies between Ensembl and UCSC annotation regarding TSS. To make sure the first exon given by ensembl is right, copy the promoter sequence
  • Go to UCSC BLAT search at http://genome.ucsc.e...t?command=start and choose the right genome (eg, human), paste the sequence there. On the result page, click browse of the first hit, this will bring you to the genome browser Page. the query sequence is now aligned with UCSC genome sequence. Zoom out a bit, you will be able to determine whether the promoter sequence matches UCSC annotation. If it matches, the sequence is very likely the right one. Here is the BRCA2 promoter sequence aligned to BRAC2 gene.
  • In UCSC genome broswer, you can turn on CpG island feature, if there is CpG island in the promoter sequence, the sequence is highly likely a true promoter. In the above example (BRCA2), a CpG island is displayed in the proximal promoter.
  • Beware some genes have alternative promoters. To find those sequences, it requires extensive bioinformatics and experimental analysis.

2. How to predict promoter sequences

... to be updated

This post has been promoted to an article

#6 Gu_Margaret

Gu_Margaret

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 17 September 2009 - 12:11 PM

I discovered a website www.mybioinfo.info, where you can search you gene and get the up-stream 10k sequence right away.

It also tell you which strand (+? or -?) the gene is on and cut the up-stream 10k according to the strand information.

Very cool site!

http://www.mybioinfo...r...1&B3=Search

#7 Mighty Mouse

Mighty Mouse

    Squeak!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 121 posts
3
Neutral

Posted 17 September 2009 - 05:36 PM

I'm a fan of the evolutionary conserved region browser for navigating the genome and determining potential promoter sequences:

http://ecrbrowser.dcode.org/

It actually makes browsing the genome fun! And it links to conserved transcription factor binding sites, and you can annotate it etc...
We are all artists...painting with experience on the canvas of life

#8 PFA-Goofy

PFA-Goofy

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 05 November 2009 - 12:00 PM

once again, pcrman saves my butt and makes my day  ;)

#9 rakun

rakun

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 29 January 2011 - 12:40 PM

Hi,

I have a dilemma. Team leader makes me find appropriate primers for MSP study of PAD2 gene. In order to designe primers I searched for promoter sequence of the gene according to the protocol given by pcrman. On the other hand I learned where transcription factors binding sites were located. Given that I decided to put primers  in the vicinity of the bindig sites. I wonder if that makes sense.

Thanks in advance!

P.S Unforunately my english is not perfect.






Recent blog entries on this topic

Photo

From: How to find promoter sequence

By pcrman in Small RNA blog, on 06 August 2010 - 01:22 PM

Many people have problem identifying or predicting the promoter sequence of a gene, or don't know how to get the actual sequence for analysis such as primer design, transcription factor binding site search, etc. Here I provide ways how I do these things. 1. How to find and retrieve promoter sequences from genome databases Promoter sequences are...

Read Full Entry →
Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.