I am trying to get PCR product from a plasmid.
The forward primer: (AAAAAAAACATATG)CAGCGGGCGCGACCCACGCTCTGG:
Backward primer: (AAAAAAAAGGATCCCTA)CTTGCTCTGCATGCTGTAGC
The sequence in () is the part I want to insert to the PCR product and are not surpose to bind to the template. I tried anealing temperature 55 and 64 degree and I also tried different amount DNA template (1ng to 200ng). But I got no band.
could anybody tell me what may be the problem?
Thank you.
PCR does not work
Started by chenx2, Dec 30 2004 01:50 PM
2 replies to this topic
#1
Posted 30 December 2004 - 01:50 PM
#2
Posted 02 January 2005 - 04:30 AM
Hi, chen,I guess the problem due to your forward primer! Too many G and C may let it not work.
paul in NanJing China
God helps them who help themselves!
God helps them who help themselves!
#3
Posted 02 January 2005 - 02:32 PM
Agree with Paul. The forward primer has a unusual high GC content. So the difference in Tm of the two primers is very big.
Double check your primer sequence to be sure there is no errors. Also check if your template DNA is good.
Double check your primer sequence to be sure there is no errors. Also check if your template DNA is good.













