Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

PCR does not work


  • Please log in to reply
2 replies to this topic

#1 chenx2

chenx2

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 30 December 2004 - 01:50 PM

I am trying to get PCR product from a plasmid.
The forward primer: (AAAAAAAACATATG)CAGCGGGCGCGACCCACGCTCTGG:
Backward primer: (AAAAAAAAGGATCCCTA)CTTGCTCTGCATGCTGTAGC
The sequence in () is the part I want to insert to the PCR product and are not surpose to bind to the template. I tried anealing temperature 55 and 64 degree and I also tried different amount DNA template (1ng to 200ng). But I got no band.

could anybody tell me what may be the problem?

Thank you.

#2 peixumol

peixumol

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 34 posts
0
Neutral

Posted 02 January 2005 - 04:30 AM

Hi, chen,I guess the problem due to your forward primer! Too many G and C may let it not work.
paul in NanJing China
God helps them who help themselves!

#3 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 02 January 2005 - 02:32 PM

Agree with Paul. The forward primer has a unusual high GC content. So the difference in Tm of the two primers is very big.

Double check your primer sequence to be sure there is no errors. Also check if your template DNA is good.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.