Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Online tools for methylation study


  • Please log in to reply
12 replies to this topic

#1 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 15 December 2004 - 01:55 PM

Here are some online resources for methylation study

CpG island prediction:

CpG Island Searcher

CpG Plot

MethPrimer

CpG island Explorer for local installation http://bioinfo.hku.hk/cpgieintro.html

Primer Design:

MethPrimer
CpG island prediction, MSP, BSP primer design.

BiSearch
BSP and MSP primer design

PerlPrimer: PerlPrimer is a free, open-source GUI application written in Perl that designs primers for standard PCR, bisulphite PCR, real-time PCR (QPCR) and sequencing. It aims to automate and simplify the process of primer design. (Local installation only)

MethBlast is a similarity search program designed to explore in silico bisulfite modified DNA (either or not methylated at its CpG dinucleotides). The tool is mainly developed to find primer binding sites and hence addresses specificity for PCR based assays that use bisulfite converted DNA as input material, including bisulfite sequencing, methylation-specific PCR (MSP), combined bisulfite restriction analysis (COBRA), bisulfite-PCR-SCCP (BiPS), methylation-sensitive single-nucleotide primer extension (Ms-SNuPE), and PCR melting curve analysis. For a review of these methods, see Liu and Maekawa, Analytical Biochemistry, 2003, 317:259-265

snake-sharmer - Restriction enzyme digest of bisulfite treated DNA (COBRA): differences between methylated/unmethylated sequences
http://195.83.84.240...ke_sharmer.html

Protocols:

Methylation related protocols

Database
DNA Methylation Database http://www.methdb.de/

DNA Methylation analysis PCR Primer Database http://medgen.ugent.be/methprimerdb/

Others
MethTools - a collection of software tools for the analysis of bisulfite treated DNA. The software does the comparison between unconverted mother sequences and deaminated sequences, generates graphical outputs of methylation patterns and methylation density, estimates the systematic error of the experiment and searches for conserved methylated nucleotide-patterns.
http://genome.imb-jena.de/methtools/

List of Promoter CpG Island Hypermethylation in Cancer
http://www.missouri....f_promoters.htm

You are welcome to add your own.

#2 methylnick

methylnick

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 245 posts
4
Neutral

Posted 09 September 2009 - 12:45 AM

Here is a new program available for the presentation of bisulphite sequencing data, to be published in Biotechniques soon.


Bisulphite Analysis Suite

#3 vmiguel

vmiguel

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 09 March 2010 - 05:12 PM

any tool to predict sites of methylation in plants?

#4 Jeronimas

Jeronimas

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 25 August 2010 - 01:37 AM

Maybe this one for plants: http://www.gmi.oeaw....n/cymate-index/

any tool to predict sites of methylation in plants?



#5 epibet

epibet

    member

  • Active Members
  • Pip
  • 18 posts
0
Neutral

Posted 16 April 2014 - 03:19 AM

Has anyone used bisearch to blast BSP primers?



#6 rakun

rakun

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 05 May 2014 - 02:27 PM

Has anyone used bisearch to blast BSP primers?

I did. Technically speaking, bisearch does "similarity search", not blast. Bisearch may be very useful for checking primer specificity. Please be more specific



#7 epibet

epibet

    member

  • Active Members
  • Pip
  • 18 posts
0
Neutral

Posted 05 May 2014 - 10:16 PM

As far as I know blast is also a similarity search tool. My problem is I have designed new BSP primers and I got multiple hits but I couldn't get a hit my target sequence. I thought thats normal since its bisulfite converted DNA. But I wondered how well this tool is working so I used some old BSP primers but I got no hit. I thought it is strange since these were working primers. I wondered whether anyone had similar problems? You had good results with this program?



#8 rakun

rakun

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 05 May 2014 - 10:58 PM

As far as I know blast is also a similarity search tool. My problem is I have designed new BSP primers and I got multiple hits but I couldn't get a hit my target sequence. I thought thats normal since its bisulfite converted DNA. But I wondered how well this tool is working so I used some old BSP primers but I got no hit. I thought it is strange since these were working primers. I wondered whether anyone had similar problems? You had good results with this program?

Hi epibet,

 

Did you check box "Bisulfite"? Maybe sounds stupid, but this type of error is very common. I checked some primers from the literature and there were no problems.

 

People forget to check the box.


Edited by rakun, 05 May 2014 - 11:02 PM.


#9 epibet

epibet

    member

  • Active Members
  • Pip
  • 18 posts
0
Neutral

Posted 06 May 2014 - 02:23 AM

yes I did check the box



#10 rakun

rakun

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 06 May 2014 - 04:04 AM

yes I did check the box

Hmmm... Maybe to check the promoter sequence... How did you get the promoter sequence? What database was used to retrieve the promoter sequence?  Could you send the primer sequences?



#11 epibet

epibet

    member

  • Active Members
  • Pip
  • 18 posts
0
Neutral

Posted 06 May 2014 - 04:35 AM

I got it from NCBI database, primers are below. 

F: 5'GAGTCGGAGAGCGTTTTTTGAG'3

R: 5'CATCCGAAAACCCAACCTCTCCGA'3



#12 rakun

rakun

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 06 May 2014 - 05:38 AM

I got it from NCBI database, primers are below. 

F: 5'GAGTCGGAGAGCGTTTTTTGAG'3

R: 5'CATCCGAAAACCCAACCTCTCCGA'3

Well, are you sure that these primers are intended for BSP? The reverse primer contains two CpGs of which one is at the 3'end? The forward contains two CpGs.



#13 epibet

epibet

    member

  • Active Members
  • Pip
  • 18 posts
0
Neutral

Posted 07 May 2014 - 02:41 AM

Yes they are BSP primers but the region I am trying to amplify is very CG rich I could not avoid the CG in primer sequence, so the actual primer has degenere primers in that positions (YG).






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.