Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Negative control for MSP


  • Please log in to reply
4 replies to this topic

#1 zzylx

zzylx

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 07 November 2004 - 11:18 PM

I used methprimer to get my MSP primer for DAPK. The unmethylation primer set works well, but the methylation primer set is very weird. The negative control always shows a ladder from the first try, only 2 or 3 times i can get clean negative control. Whenever there is a ladder in the negative control, the product is almost 5-10 bases larger than the one that I expected, but right size band showed when the negative control is clean. I think i didn't contaminate the reagents. Is there any possibility that the primer sets already degrated?

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 08 November 2004 - 02:58 PM

It may not be related to primer degradation. What is your negative control, unconverted DNA or water? If you use unconverted DNA, you should also use water as control to exclude contamination.

There are two possibilities:

1) contamination
2) nonspecific pairing. How many non-CpG Cs are in the M primer? Try raising the annealing temperature a bit.

#3 zzylx

zzylx

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 08 November 2004 - 04:19 PM

I use water as negative control.

#4 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 08 November 2004 - 06:13 PM

If water is used for negative control, there is no doubt that contamination is the culpit.

#5 zzylx

zzylx

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 09 November 2004 - 02:25 PM

Thank you so much, pcrman. But i still have a question on it, here is my primer set:

5'GGGATTCGGTAATTCGTAGC3'
5'AAACTAACCGAAACGACGAC3'

do you think my ladder caused by amplicon prime itself in some way to generate concatanated products which will accumulate in number and size as the PCR cycles and form ladders? I checked my primer, and found there are several internal repeats, which would allow the PCR product to act as a primer on itself.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.