Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

BSP and MSP primer check

  • Please log in to reply
2 replies to this topic

#1 pisa1234



  • Members
  • Pip
  • 2 posts

Posted 03 November 2004 - 08:56 AM

is it ok for the following methprimer

Left primer 206 30 56.49 43.33 5 GAAGAAAATTAGAGAAAAGTAGGTAGTTAA
Right primer 473 26 53.69 50.00 8 TTTTAAACTTTCTAAAAAACCTAAAC
Product size: 268, Tm: 72.0, CpGs in product: 29

1 Left M primer 334 24 59.83 62.50 4 TAGGCGGGAAGTGTATAAAGGTAC
Right M primer 469 25 59.58 64.00 8 AAACTTTCTAAAAAACCTAAACGCC
Product size: 136, Tm: 70.6
Left U primer 334 26 59.30 61.54 4 TAGGTGGGAAGTGTATAAAGGTATGA
Right U primer 470 26 55.95 61.54 8 TAAACTTTCTAAAAAACCTAAACACC
Product size: 137, Tm: 68.7


Primer Start Size Tm GC% 'C's Sequence
1 Left primer 32 30 56.49 43.33 5 GAAGAAAATTAGAGAAAAGTAGGTAGTTAA
Right primer 299 26 53.69 50.00 8 TTTTAAACTTTCTAAAAAACCTAAAC
Product size: 268, Tm: 79.2, CpGs in product: 29
Primer Start Size Tm GC% 'C's Sequence
1 Left M primer 160 24 59.83 62.50 4 TAGGCGGGAAGTGTATAAAGGTAC
Right M primer 295 25 59.58 64.00 8 AAACTTTCTAAAAAACCTAAACGCC
Product size: 136, Tm: 75.1

#2 pcrman



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts

Posted 03 November 2004 - 09:22 AM

They seem OK to me. Just go ahead with your PCR.

#3 pisa1234



  • Members
  • Pip
  • 2 posts

Posted 03 November 2004 - 09:27 AM

Thank you.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.