Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Primer design


  • Please log in to reply
6 replies to this topic

#1 qnc

qnc

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 13 October 2004 - 07:39 AM

I want to design primers that will have 5' restirction sites.

I have to amplify from a clone or from cDNA so I need the atg and the sequence in capitals to be amplifed upto TGA stop

I need to add SpeI at 5'(actagt) and SalI at 3' (gtcgac) for ligation of the product. both need 0bp extra for cut however I have added 1bp to be sure and digestion in compatible buffer is 75% effiency so plan to do a long digest overnight.

Basically I want to know do I design just on the section that will anneal or do I need to include the resitions sites that I am adding as well to design.

I tried primer3 but keep getting "High end self complementarity" does this matter much

here is part of the sequence just in case anyone can see an obvious primer combo

actagtATGTCTCTGGCAGATGAGCTCTTAGCTGATCTCGAAGC---approx 1500bp---CATGGCTGAGTTCCTCAAGGTCAAGGGCGAGAAGAGTGGCCTTATGTCCACCTGAgtcgac

Can anyone help?

Edited by qnc, 13 October 2004 - 08:12 AM.


#2 jadefalcon

jadefalcon

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 223 posts
1
Neutral

Posted 14 October 2004 - 02:53 AM

Hi there!

the program i use, "primer" came up with this pair:

forward primer  : AGCTCTTAGCTGATCTCGAAGC         Tm = 59.6
reverse primer  : CATAAGGCCACTCTTCTCGC           Tm = 60.0

usually the computed combinations worked for me!

mike
--- He who finds typos may keep them! ---

#3 qnc

qnc

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 14 October 2004 - 03:36 AM

Cheers for the primers.

However the forwrd doesn't include the "ATG..." and when cloned the product will not be the full protein I wanted to express.

The problem is that I need the full protein product expressed and the construct has a different promoter to that commercially supplied.

I have inserted my desired promoter already. Now I want to insert my desired expression product.

To do that I will need to add restion sites to it, as outlined above . Sites that do not occur in my inserted promoter and also allow for correct orientation. I wanted to maximise this as blue, white screening was lost after the promoter was inserted. So I would be picking colnies that had self ligated or that had the second insert hoepfully the right orientation. This would hoepfully increase the chances of finding a colony with the deisred inserts.

I guess what i was looking for was how much of the sequence starting actagtATGTCTCT and ending ACCTGAgtcgac to include. E.g. forward actagtATGTCTCT upto 27 bp with only 20bp anneling giving a Tm of 60C.

Also as the lowercase letters are not actually annealing, do I design the primers with them absent or do I need to consider them because of things like hairpins etc... which can affect the PCR effiency?

I have found that programms are great for picking primers when a generous flanking sequence is provided however when you are constrained by your start and end point I haven't found one that can say well the best you can get from this sequence is 22bp from the specified points.

Can your primer program do this kind of analysis?

Thanks for efforts

#4 jadefalcon

jadefalcon

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 223 posts
1
Neutral

Posted 14 October 2004 - 06:21 AM

forward
ACTAGTATGTCTCTGGCAGATGAGCTCTT
reverse
GTCGACTCAGGTGGACATAAGGTGACC

Could be a functional primer pair. the reverse primer can't be made longer, says my programme, since the stem loops will be unevitable...

mabe you're lucky, I can't do more for you at the moment!

mike
--- He who finds typos may keep them! ---

#5 qnc

qnc

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 14 October 2004 - 06:38 AM

These look good the only problem is that the last five bases of the reverse are not in the original sequence but have replaced them anyway and see what happens.

Where did you get your program from?

Edited by qnc, 14 October 2004 - 06:59 AM.


#6 jadefalcon

jadefalcon

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 223 posts
1
Neutral

Posted 14 October 2004 - 09:59 AM

OOoops, made a mistake by copy/pasting...sorry

i meant: (as you've figured out)

reverse
GTCGACTCAGGTGGACATAAGGCC

don't know where those other bases came from?!?

the proramme is located at a non-free website in germany, which requires a login and regular payment...maybe outside in the net there's something similar, as i seem to recall a earlier version of "primer" could have been part of the then widely spread and used gcg-package, but my memory may play tricks on me there!

mike
--- He who finds typos may keep them! ---

#7 qnc

qnc

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 15 October 2004 - 01:13 AM

What is the URL of the website will take a look at it

I usaually use Primer3

but it was not up to this job.

This forum is really good by the way very impressed.

Keep up the good work guys and gals




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.