Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

TA cloning for sars cov 2 nucleocapsid protein.


  • Please log in to reply
4 replies to this topic

#1 akremon

akremon

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 19 February 2021 - 12:38 PM

hi everyone. ı want to do recombinant nucleocapsid protein for sars cov 2. ı will use TA clonig (pet sumo cloning kit) . which primer do you recomend for gen . or how ı can find right primer. please help me. its very important for me. 

 



#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,711 posts
567
Excellent

Posted 22 February 2021 - 04:18 PM

And your purpose is to produce protein from the nucleocapsid expression vector? If so, you most likely want primers that bind at the very start and very end of the nucleoprotein sequence respectively.



#3 akremon

akremon

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 23 February 2021 - 03:31 AM

thank you my friend. you say ı did it . it s ok. but ı find a article have a primer . ı went to pubmed. than ı use blast for primer. pubmed  didnt find (article primer ) in NCBI Reference Sequence for sars cov 2. ı think also ı search my primer in google . google didnt find my primer. 

 

can you tray my primer. 

nucleocapsid gene.

ATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAA

 

my primer  forward: ATGTCTGATAATGGACCCCA

reverse: TTAGGCCTGAGTTGAGTCAG

 

do you think this Primer its true.



#4 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,711 posts
567
Excellent

Posted 23 February 2021 - 02:53 PM

The look fine for this purpose, assuming you have cDNA from the virus that you can amplify. It would pay to do a Primer BLAST on the primers to ensure that they don't hit host genome significantly. Using the Primer BLAST section for Primer Pair Specificity Checking Parameters, you can either leave it as nr or specify the host genome to BLAST against.



#5 akremon

akremon

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 24 February 2021 - 02:09 AM

thank you my friend. 

best regards






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.