Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Complimentary Strand in the 5'-3'


  • Please log in to reply
1 reply to this topic

#1 CM0802

CM0802

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 13 September 2020 - 06:39 AM

Greetings to everyone!

 

I'm a university student working on an assignment with another classmate and I'm not sure I have identified the complimentary strand in the 5'-3' direction for the DNA fragment below.

 

My original answer is: TGACTAAGCTACGTTACCGCATGTAGGCATGCATCTCGATAGCTACGTTAGCCACTAGATTCA

 

However, I have a classmate that has a different answer: ACTTAGATCACCGATTGCATCGATAGCTCTACGTACGGATGTACGCCATTGCATCGAATCAGT

 

He says that my answer is not correct because it is in the 3'-5' direction. Can someone please help me figure out who came up with the right complimentary strand in the 5'-3' direction? 

 

Thank you!

 

 

 

DNA Fragment:

3’ – ACTGATTCGATGCAATGGCGTACATCCGTACGTAGAGCTATCGATGCAATCGGTGATCTAAGT – 5’

      

Forward primer:

5’ – CTACGTT – 3’

 

Reverse primer:

3’ – GTGATCT – 5’

 



#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,706 posts
567
Excellent

Posted 13 September 2020 - 12:54 PM

Note: compliment = saying something nice ("You look lovely today"), complement = paired with A/T, G/C in base terms. Be aware of which you mean - your teacher certainly should know the difference.
 
What the teacher wants depends on the wording of the question - you need to go and read this carefully.
 
There are complementary strands and reverse-complementary strands.
 
The complementary is one where you have the sequence kind of reflected - the exact complement of the top strand. In the example below, the top strand is TTCCAAG, the complement is the one below that, and you would read it in the 3' to 5' direction.
5' TTCCAAG 3'
3' AAGGTTC 5'
 
The reverse complement is similar, but the way you read them is, as you should, from 5' to 3'. In the example below you can see the difference - note the top two are the same as in the example above, the 3rd one is the reverse complement of the first strand, and is the equivalent of mRNA if the first strand is DNA: 
5' TTCCAAG 3'
3' AAGGTTC 5'

5' CTTGGAA 3'





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.