Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

PCR Cloning - Please Help - Urgent


  • Please log in to reply
1 reply to this topic

#1 jonathannimal

jonathannimal

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 14 September 2004 - 11:27 PM

I have used two primers Forward and reverse to amplify my PCR fragment. I have used two restriction sites SalI (in the forward primer) and BamHI (in the reverse primer).

There are the primers:

Cry4BSF: 5’- GGTCGACGTTCATAGGAATCCGTATCA -3’ (27 Mer) - Forward

Cry4BBR: 5’–GGGATCCTCACTCGTTCATGCAAA-3’ (24 Mer) - Reverse

I am not able to clone the product. I saw in the discussion that there needs to be addition of sokme bases. Please help me & tell me that what sort of bases need to be added.

Please help me I am in a urgent condition.

With regards
nimal

#2 blasko

blasko

    member

  • Active Members
  • Pip
  • 13 posts
0
Neutral

Posted 15 September 2004 - 01:19 AM

You should add plus 3 nucleotides next to the recognition enzyme site.
Cleavage %
2 hr 20 hr
In case of BamHI: cgcGGATCCgcg >90% >90%


SalI: ACGCGTCGACgtcggc 10% 75%

by NEB.


Bye!
B.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.