Jump to content


- - - - -

Smearing on Gel


28 replies to this topic

#16 lula

    Enthusiast

  • Active Members
  • PipPip
  • 44 posts

Posted 04 March 2005 - 04:27 AM

the PCR trouble shooting link sent to kudna by ihab is great
thanks ihab
and for kudna im happy u solved ur problem, i had a simillar one and turned out to be that the TAE buffer we are REUSING has exhusted it self
things got better afterpreparing fresh solutions

Edited by lula, 04 March 2005 - 04:28 AM.


#17 aimikins

    Sunflower

  • Moderator
  • PipPipPipPipPip
  • 113 posts

Posted 24 March 2005 - 01:22 PM

It seems that this topic has been answered to death, but I had a thought that no one else brought up, and it may help someone in the future?

Oligos will degrade over time, even when properly resuspended in nuclease free water or buffer and aliquoted and stored at -80...eventually they will degrade and this could cause non-specific priming. Based on my personal experiences in the lab, I would consider this problem first if I began to see smeary gels, particularly if I were careful about good technique everywhere, especially if the problem seems to get worse over time.

I had a similar experience once and spent a few months going through every detail of my protocol...remade and reordered my other solutions 8 trillion times and was very frustrated...and it just turned out to be oligo degradation.
"it is a miracle that curiosity survives formal education" -A.E.

#18 lula

    Enthusiast

  • Active Members
  • PipPip
  • 44 posts

Posted 25 March 2005 - 01:44 AM

hi
do mean by oligonucleotides the primer stock prepared ???
and if that is the case how can u maaake sure that ur primer stock is dead???????

#19 saly

    member

  • Active Members
  • Pip
  • 8 posts

Posted 26 February 2009 - 06:13 AM

Hi,
please can anybody help me

for bad lucky, my gen (the sequence ) until now not identify from fungi, but identified from higher plant only. so, i used this sequence from higher plant to design from it my primer ( gen in fungi is the same function and nam as from higher plant) so i used it.

**1- in the first i designed from conserved reigon but formed bad result and primer- dimer ( in sample brode band, in control thin band but the both at same size) may be primer-dimer,
**2- design as program by take part of sequence similar in all speacies of plant but result not good also, same band in control and sample as same size but when increase annealing disappeared in both although, Delta G -4 only.

** 3- then designed another primer as sequence of primer used in higher plant this is:
forwared: 5'- AACATAGATGGTGTAGAGGGT -3'

reverse : 5'- GATAGTTTCTATCGGCTGCAT -3'

HETERO-DIMER ANALYSIS

Primary Sequence

5'- AACATAGATGGTGTAGAGGGT -3'

Secondary Sequence

5'- GATAGTTTCTATCGGCTGCAT -3'

Maximum Delta G -37.96 kcal/mole

Delta G
-5.61 kcal/mole

Base Pairs
5

from this data i can said the % of formation of primer -dimer was very less.

**in higher plant must was the product size 420 Bp not (100-150 Bp) only. in the first : at RT-PCR (RNA) formed same band at same size in control but when increased the anneling the band disappeared from control but Continued to found in sample and i send my picture to see it. this is change in interpretation what is happening?

I used PCR reaction (from DNA) to confirm the result because i am afraid from this band may be primer- dimer only not original band on the basis of appearence with all primer used but with chang the case from (" appeared" & "disappeared") with increase annealing.

i found same band at same size in RCR- reaction in control & sample but this at low annealing (55 o C ) temperature. i will increase the annealing (60 oC) as i used in RT-PCR may be disappeared from control, i hope. so, i can't know what this is means? rhight sequence or primer- dimer only.

sorry,sorry for elongation
saly4ever@hotmail.com

#20 gorkin

    member

  • Active Members
  • Pip
  • 10 posts

Posted 26 March 2009 - 07:47 AM

I had the same problem a while back. I struggled with it for about 1.5 years, trying to work things out but I got nowhere. After about 6 months of waiting around I tried again and all of a sudden everything worked and I got bright bands. I ordered everything new, but used the same primers and templates.

#21 drjcroberts

    member

  • Active Members
  • Pip
  • 9 posts

Posted 12 June 2009 - 10:15 AM

hi,

this can often be caused by excessive DNA template and primer. check your concentrations.

J

#22 isbow

    member

  • Active Members
  • Pip
  • 10 posts

Posted 07 July 2009 - 03:48 AM

Hi!

We are also working with fungi (from Lichen). We now use the quiagen Miniplant kit to purify the samples which really gives nice genomic DNA. I then perform PCR with PCR-beads from GE healthcare (ready to go beads). There you only add Primer, water and 2,5µl DNA (1:20 dil.). They really work perfectly. We had a lot of trouble with smear and everything. There are always these stupid stuff things left in the fungi which also trouble PCR. Try our method it really works perfectly!!

Have fun!!

#23 William Parkar

    member

  • Active Members
  • Pip
  • 9 posts

Posted 21 April 2010 - 10:22 PM

The only thing I can think of to produce long smears is chromosomal DNA from bacteria (what I'm used to working with). I don't know what your template is but, if there is too much of it, that will show up on a gel.



Research Papers

#24 gaby

    member

  • Members
  • Pip
  • 2 posts

Posted 19 May 2010 - 12:46 AM

ihab thank you so much for the website on pcr troubleshootings.i'm new in this field.thanks
gaby

#25 chocochoco

    member

  • Members
  • Pip
  • 1 posts

Posted 27 May 2010 - 06:49 PM

That's also my problem. Thanks for your advices!

Edited by HomeBrew, 28 May 2010 - 03:45 AM.
removed irrelevant link


#26 ana moreira

    member

  • Members
  • Pip
  • 2 posts

Posted 04 June 2010 - 01:11 AM

Hi!

I also had this problem in some PCR amplifications. Sometimes I have a big smear but I can visualize a "band", but I can't isolate and amplifly this specific band.

This happens specially when I'm performing a 5'RACE, ie, trying to amplify the 5'utr of a specific gene.

I don´t understand why it's happening because I use specific primers for that region and the ideal conditions (Temperature, MgCL, enzyme,...).

Someone can help me?

Thanks!

#27 eLabProtocols

    member

  • Members
  • Pip
  • 4 posts

Posted 20 September 2010 - 05:53 AM

View Postkudna, on 03 September 2004 - 11:47 AM, said:

HI,
I was wondering if anyone has answers as to why my PCR product is one big streak from well to end. Somtimes a band shows up where expected but in the background (or foreground) is the large, sometimes bright streak. We've been having this problem for a while. Sometimes it's not there but nothing different was done with extraction or PCR parameters. We use optimal thermocycling conditions for our primers, so we're pretty sure it's not in the PCR reaction.
We've also encountered bright bands in wells followed by those streaks of some samples. Any suggestions would be greatly appreciated!

Thank you in advance.
kudna


If your buffers are ok, I would say that you are possibly using too much chromosomal DNA as a template.
Chromosomal DNA is the only thing I know that runs as a smear on you gel! Try to make some template diltions

eLabProtocols
An online tool to find, organize and share protocols

#28 Evanescence

    Enthusiast

  • Active Members
  • PipPip
  • 45 posts

Posted 04 August 2011 - 08:57 PM

Ali was right, it sounds annealing temperature matter in this case...maybe you need to do gradient pcr...!

good luck Maza,
It's better not to lost hope
coz we will learn more if we dare to cope

Evanescence

#29 stagia

    member

  • Members
  • Pip
  • 1 posts

Posted 27 October 2011 - 11:41 AM

hi
I had the same problem. I am trying to amplify a 1.6kb product using as template cDNA synthesized either with oligodT or with gene specific reverse primer. what I get is a band of correct size and a smear around it only from 1kb to 2.5kb. Have you any idea what I should do? I have tried 3 different polymerases and almost always the same picture
thanks
stagia





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.