Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

how to predict amplicon size?


  • Please log in to reply
1 reply to this topic

#1 yobou

yobou

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 100 posts
1
Neutral

Posted 09 May 2018 - 01:38 PM

dear all

I would greatly appreciate if you help me know how to predict the amplicon size in conventional PCR using the sequences of forward and reverse primers? is there a website that can provide such info?

here are the sequences of alpha-tubulin primers used:

forward: ACACCTTCTTCAGTGAGACAGG
reverse: CTCATTGTCTACCATGAAGGCAC
thanks


#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,540 posts
548
Excellent

Posted 10 May 2018 - 07:14 AM

Try the primer3 site - you can put in the sequence of your gene and add the primer sequences, so I should show you where these match.

 

Otherwise you can align them to the sequence using any number of alignment programs and note the places they bind.






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.