9 replies to this topic

[Mashudu]

I have to produce a vaccine using recombinant DNA technology. The gene i want to amplify is to be expressed in a Yeast vector. But i am suppose to DESIGN 2 sets of primers! One without his tag and the other with his tag. I will amplify the gene, subclone it in pGEMT, the clone in pET28a(+) which come with his tag. Purify and finally clone in a yeast vector (pKOV96) and express in yeast cells.

 

How do i go about designing both sets of primers??????? I have to amplify the gene from the N- to the C-terminal to increase the immunogenecity of my vaccine. Can anyone please help? Here is the Clostridium perfringens strain DNA:

 

ATGAAGAAAAAATTTATTTCATTAGTTATAGTTAGTTCACTTTTAAACGGATGCCTATTATCACCAACTT
TAGTGTATGCAAATGATATAGGTAAAACTACTACTATAACTAGAAATAAGACATCAGATGGCTATACTAT
AATTACACAAAATGATAAACAGATAATATCATATCAATCTGTTGACTCTTCAAGTAAAAATGAAGATGGT
TTTACTGCATCTATAGATGCTAGATTTATCGATGATAAATATTCATCTGAAATGACAACTTTAATAAACT
TAACTGGATTTATGTCTTCAAAAAAAGAAGATGTTATAAAAAAATACAATTTGCATGATGTTACTAATTC
TACTGCAATTAATTTTCCGGTTAGATACTCGATTTCTATTTTAAATGAAAGTATTAATGAAAATGTAAAA
ATAGTTGATAGTATTCCTAAAAATACAATTTCTCAAAAAACTGTATCCAATACAATGGGATACAAAATAG
GAGGTTCAATTGAAATAGAAGAAAATAAACCTAAAGCTTCAATTGAAAGCGAATATGCTGAATCATCTAC
AATAGAATATGTCCAACCTGATTTTTCTACTATACAGACAGATCATTCAACCTCTAAAGCTTCATGGGAT
ACAAAATTTACAGAAACTACTCGTGGTAATTATAATTTAAAATCAAACAACCCTGTATATGGAAATGAAA
TGTTTATGTACGGAAGATATACTAATGTTCCTGCAACTGAAAATATAATTCCAGATTATCAAATGTCAAA
ATTAATAACAGGTGGTTTAAACCCTAATATGTCTGTAGTTCTAACTGCTCCTAATGGTACTGAAGAATCT
ATAATAAAAGTTAAAATGGAGCGTGAAAGAAACTGTTATTATCTTAATTGGAATGGTGCTAACTGGGTAG
GACAAGTCTATTCCAGGCTAGCTTTTGATACCCCAAATGTAGATAGTCATATATTTACATTCAAAATAAA
TTGGCTTACTCACAAAGTAACAGCTATTTAG

[bob1]

Think about it a little - if you need to include the whole gene (and only the whole gene), where would your primers bind?

[Mashudu]

I have thought about it. The solution would be to find the longest open reading frame starting with an ATG. But will that not limit the chances of my vaccine to induce an immune respond? What do you suggest that i should do?

[bob1]

You are correct, the longest open reading frame is the one you want. Basically this means that your primers will bind to the first and last 20ish bases of the sequence. I see that you are cloning into pGEM-T, so you need an A overhang; Taq polymerase can add this. However, to ensure that you are more likely to get the sequence you want, you should amplify the sequence with a proof-reading polymerase (you may need to purify here), then add the A overhang by adding Taq (and buffer if needed) and dATP and incubating for 15 min. 

 

As you plan on subcloning into the HIS vector - make sure your sequence doesn't contain a stop codon before the HIS, you may also want to remove the N terminal Methionine, but this is often not essential.

 

As to limiting the chances of inducing an immune response... no, why would it? It is the same protein you want to target, so why would this decrease the chance? Now, having said that, antibody epitopes are usually quite small, somewhere between 4 and 8 amino acid residues in length usually. If you use the full length protein, you should get a response against the whole protein, but sometimes it is a good idea to choose some short sequences that are on the surface of the protein (in native, correctly folded form) that show strong antigenic potential, and get those made, then use them to raise an immune response.

 

What you do is up to you... it's your project. It is usually quite easy to design the primers and amplify sequence. Cloning can take a little longer, but should work well if you pay attention to the details.

[Mashudu]

Am knew to molecular techniques, please bare with me. The protein that i am expecting has a molecular weight of 44 kDa. The longest ORF of the above gene results in a far less molecular weight from what i am expecting, hence i wanted to  amplify the whole gene. 

[bob1]

I did a BLAST of your gene and it looks like the C. perfringens beta-toxin (leukocidin) - if this is correct, then this is as big as it gets. It has a calculated mass of about 38 kDa. If you are running SDS-PAGE gels for this, it is common for proteins to NOT run at the predicted size, despite the denaturing conditions of SDS-PAGE gels. The mass can also be affected by post-translational modifications such as phosphorylation, glycosylation etc..

[Mashudu]

It is the same gene. I also did a BLAST using bioinformatics.org to check for the molecular weight of the gene and find it to be 84.12 kDa. I also checked for the ORF starting with ATG and found out to be the whole gene (N- to C terminal), which i think its good for the purpose of my research (Vaccine development).

 

I then designed first pair of primers for the pET28(+) vector as follows:

 

Forward: catATGAAGAAAAAATTTATTTCATTAG

 

Reverse:ctcgagAATAGCTGTTACTTTGTG

 

where in the forward primer: lower case (cat + ATG represent restriction enzyme Nde1). The ATG is also the start codon of the gene of interest.

 

For the reverse primer: ctcgag represent restriction enzyme Xho1. ( Notice that i removed the stop codon TAG on the reverse primer which is at the end of my gene of interest).

 

I then continued to design second pair of primers to amplify the products of pET28a(+) into the pKOV96 yeast vector as follows:

 

Forward primer: ggtaccATGATGAAGAAAAAATTTATTTCATTAG

where ggtacc is Acc651 restriction enzyme and i added an extra ATG just before the ATG of the gene of interest as is required for the pkov96 yeast vector.

 

This forward primer is the same as the forward primer of the first pair of primers for the pET28a(+) vector). The only difference is the addition of extra ATG and the reverse primer which is as follows:

 

Reverse primer: cctaggCACCACCACCACCACCAC

where cctagg is the Avr11 restriction enzyme and the CACCACCACCACCACCAC is the his-tag present in the pET28a(+).

 

The addition of the his tag at the C-terminal is to facilitate with purification.

 

NB: Really hope this makes sense. Will really appreciate your response as i do not want to order primers that will not work like a did last year.

[bob1]

The primers should work for amplification, but the restriction enzymes will not work well right at the ends of the sequence. You need to add 3-6 bp before the restriction sites to ensure that the enzymes will function (check out NEB cleavage near ends of DNA fragments). Some of your enzymes are not listed in the table I just directed you to, so use 6bp.

 

You may also want to check out Kozak sequences, and maybe add them to your forward primer before the ATG.

 

You may have some problems with primer hairpins with your forward primer in each case. This is because of the large sequences of A's and T's. You can add a chaotrope such as DMSO to overcome this.

[Mashudu]

Thank you very much for your responses. Talking about the Kozak sequence (gccgccacc) for yeast expression, do i have to add the whole Kozak sequence? Is the addition of an extra ATG before the ATG start codon not efficient enough to initiate translation at the N-terminal?

[bob1]

Depends on the system as to whether the extra ATG is enough. If the manual for that system says that it should work, I would go with that.