Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Designing primers with his-tag for pET28a+ vector

pcr cloning molecular biology biochemistry primer design

  • Please log in to reply
3 replies to this topic

#1 Mashudu

Mashudu

    member

  • Active Members
  • Pip
  • 16 posts
0
Neutral

Posted 03 September 2016 - 12:35 PM

I would like anyone to give me a detailed answer to my question if possible. I have a sequence for C.perfringens alpha toxin, i am suppose to design primers with his-tag for cloning in pET28+ vector.Am new to molecular biology and really dont know where to begin.Anyone who can help please?

 

AAGCTTGATATGGACTTTTTAGCAATATTAACAGCCTCATCTAGGTTAGGATTTAGAAGAGGAAGTAGTG
CTTCTGAGAATCTAGCTAAGTTCCATAAGGCCATATTAGGTTGATTTCCATAGGCATATCTACCAGCATA
ATCAATGGAACTAAATACTGTGTTTGTATCATAAGTATCCATAAATGCACATGGTCCATAATCTATAGTT
TCTCCTGAGATTACCATATTATCAGTGTTCATAACCCCATGAATGAATCCAACACTTTGCCACTTAACTA
TAAGTTCAGCTTGACGATTTATTACCTCTTCAAGAAATAAAATATATTTATTTTCACTATTAGCTATATT
AGGAAAGTGTCTTTTAATAGTGTAGTCAGCAAGACTTTTAAGATCCTCTAAAGTACCCCATTGAGCTGCA
TAAGCAAAAGTTCCAACTCTAATGTGACTAGAAGCTATTCTTGTTAATATAGCACCTTGTTCAAATTTTT
CTCTTAAAACTTCCTCACCAGTACTTACTACAGCAAGGCTTCTAGTTGTAGGAATTCCAAGACTATGCAT
ACCTTCACTTATTATATATTCTCTAAGCATAGGTGCAAGGGCAGCCTTTCCATCTCCACCTCTTGAATAT
ATTGTTCTACCAGACCCTTTTAATTGAACATCATATCTTTTACCATCTTTAGTTACATGTTCTCCTAATA
AGAGTGCTCTACCATCTCCTAGCATTGTAAAATGGCCAAATTGGTGACCGGCATAAGCCTGTGCAATTGG
GGTAATACCTGGGAAAGTTTCATTTCCTGCAAATATATTAAGTCCAAAATCGCTGTTTAAAATTTCTTCA
TTAAGCCCAAGTTCTTTAGCAAGAGAAGTATTAAACTTAATAAGTTTAGGATTTTTTGAACCCTTTGGAT
TTTGTTCACTAAAGAATATATTTGGAAGAGTTAAATAAGTATTTTCTAGGTTAAAACCTGTTTTTGATTG
AAAATTTTTATTATCCATATTAAAATCCTTTGCCTTATAATTTATTTCAAATTTTATTCCATCCCTTATA
TTATGAGTAAAAATTCTTATTAAATTAAAAAACAATATTTAACTTATTATAACACTAATAATTGTAAATT
TTCATATTAAAAATAAGTTTAATAATTTAGAGTGGGTGAGTTTAGATATTTTAAATTAAAATTTGAATTT
TATTAAAAAATATTTAAAAAATATTCAAAAGTTTAGTGAGGTTATGTTAATTATATGGTATAATTTCAAT
GCGAGTGTTAATCGTTATCAAAAAGGGGAGATTAATACTTGAAAAAAATTAACGGGGGATATAAAAATGA
AAAGAAAGATTTGTAAGGCGCTTGTTTGTGCCACGCTAGTAACTAGCCTATGGGCTGGGGTATCAACTAA
AGTCTACGCTTGGGATGGAAAAATTGATGGAACAGGAACTCATGCTATGATTGTAACTCAAGGTGTTTCA
ATCTTAGAAAATGATATGTCCAAAAATGAACCAGAAAGTGTAAGAAAAAACTTAGAGATTTTAAAAGATA
ACATGCATGAGCTTCAATTAGGTTCTACTTATCCAGATTATGATAAGAATGCATATGATCTATATCAAGA
TCATTTCTGGGATCCTGATACAAATAATAATTTCTCAAAGGATAATAGTTGGTATTTAGCTTATTCTATA
CCTGACACAGGGGAATCACAAATAAGAAAATTTTCAGCATTAGCTAGATATGAATGGCAAAGAGGAAATT
ATAAACAAGCTACATTCTATCTTGGAGAAGCTATGCACTATTTTGGAGATATAGATACTCCATATCATCC
TGCTAATGTTACTGCCGTTGATAGCGCAGGACATGTTAAGTTTGAGACTTTTGCAGAAGAAAGGAAAGAA
CAGTATAAAATAAACACAGTAGGTTGCAAAACTAATGAGGATTTTTATGCTGATATCTTAAAAAACAAAG
ATTTTAATGCATGGTCAAAAGAATATGCAAGAGGTTTTGCTAAAACAGGGAAATCAATATACTATAGTCA
TGCTAGCATGAGTCATAGTTGGGATGATTGGGATTATGCAGCAAAGGTAACTTTAGCTAACTCTCAAAAA
GGAACAGCAGGATATATTTATAGATTCTTACACGATGTATCAGAGGGTAATGATCCATCAGTTGGAAATA
ATGTAAAAGAACTAGTAGCTTACATATCAACTAGTGGTGAAAAAGATGCTGGAACAGATGACTACATGTA
TTTTGGAATCAAAACAAAGGATGGAAAAACTCAAGAATGGGAAATGGACAACCCAGGAAATGATTTTATG
GCTGGAAGCAAAGACACTTATACTTTCAAATTAAAAGATGAAAATCTAAAAATTGATGATATACAAAATA
TGTGGATTAGAAAAAGAAAATATACAGCATTCCCAGATGCTTATAAGCCAGAAAACATAAAGGTAATAGC
AAATGGAAAAGTTGTAGTTGACAAGGATATAAATGAGTGGATTTCAGGAAATTCAACTTATAATATAAAA
TAATAAAAGTAAAAAAATAATTATTGGTTTTGGTGGTATTTACAAAATAAAAGCTT

 


#2 827753

827753

    member

  • Active Members
  • Pip
  • 17 posts
3
Neutral

Posted 04 September 2016 - 11:31 PM

Ok.  First I pasted the sequence above into http://www.ncbi.nlm.nih.gov/orffinder/ and found the longest open reading frame.

 

Then I googled "C.perfringens alpha toxin" , and from the wikipedia page for it followed the entrez link to here: https://www.ncbi.nlm...ids=988262&rn=1, and from there I clicked on the FASTA link to get the nucleotide sequence here: https://www.ncbi.nlm...=48590&to=49786

 

Then I compared both the DNA nucleotide sequences of these two pieces of information and the translated protein sequences (http://web.expasy.or...ranslate/dna_aa or via the orffinder tool linked above).  They are not identical, but are very close (you can do this with BLAST and get exact alignments here: https://blast.ncbi.n...h.gov/Blast.cgi - choose the align two sequences option).  So I assume that the longest open reading frame in your sequence of interest it what you want to amplify.

 

That is this (in bold and underlined):

 

AAGCTTGATATGGACTTTTTAGCAATATTAACAGCCTCATCTAGGTTAGGATTTAGAAGAGGAAGTAGTG CTTCTGAGAATCTAGCTAAGTTCCATAAGGCCATATTAGGTTGATTTCCATAGGCATATCTACCAGCATA ATCAATGGAACTAAATACTGTGTTTGTATCATAAGTATCCATAAATGCACATGGTCCATAATCTATAGTT TCTCCTGAGATTACCATATTATCAGTGTTCATAACCCCATGAATGAATCCAACACTTTGCCACTTAACTA TAAGTTCAGCTTGACGATTTATTACCTCTTCAAGAAATAAAATATATTTATTTTCACTATTAGCTATATT AGGAAAGTGTCTTTTAATAGTGTAGTCAGCAAGACTTTTAAGATCCTCTAAAGTACCCCATTGAGCTGCA TAAGCAAAAGTTCCAACTCTAATGTGACTAGAAGCTATTCTTGTTAATATAGCACCTTGTTCAAATTTTT CTCTTAAAACTTCCTCACCAGTACTTACTACAGCAAGGCTTCTAGTTGTAGGAATTCCAAGACTATGCAT ACCTTCACTTATTATATATTCTCTAAGCATAGGTGCAAGGGCAGCCTTTCCATCTCCACCTCTTGAATAT ATTGTTCTACCAGACCCTTTTAATTGAACATCATATCTTTTACCATCTTTAGTTACATGTTCTCCTAATA AGAGTGCTCTACCATCTCCTAGCATTGTAAAATGGCCAAATTGGTGACCGGCATAAGCCTGTGCAATTGG GGTAATACCTGGGAAAGTTTCATTTCCTGCAAATATATTAAGTCCAAAATCGCTGTTTAAAATTTCTTCA TTAAGCCCAAGTTCTTTAGCAAGAGAAGTATTAAACTTAATAAGTTTAGGATTTTTTGAACCCTTTGGAT TTTGTTCACTAAAGAATATATTTGGAAGAGTTAAATAAGTATTTTCTAGGTTAAAACCTGTTTTTGATTG AAAATTTTTATTATCCATATTAAAATCCTTTGCCTTATAATTTATTTCAAATTTTATTCCATCCCTTATA TTATGAGTAAAAATTCTTATTAAATTAAAAAACAATATTTAACTTATTATAACACTAATAATTGTAAATT TTCATATTAAAAATAAGTTTAATAATTTAGAGTGGGTGAGTTTAGATATTTTAAATTAAAATTTGAATTT TATTAAAAAATATTTAAAAAATATTCAAAAGTTTAGTGAGGTTATGTTAATTATATGGTATAATTTCAAT GCGAGTGTTAATCGTTATCAAAAAGGGGAGATTAATACTTGAAAAAAATTAACGGGGGATATAAAAATGA AAAGAAAGATTTGTAAGGCGCTTGTTTGTGCCACGCTAGTAACTAGCCTATGGGCTGGGGTATCAACTAA AGTCTACGCTTGGGATGGAAAAATTGATGGAACAGGAACTCATGCTATGATTGTAACTCAAGGTGTTTCA ATCTTAGAAAATGATATGTCCAAAAATGAACCAGAAAGTGTAAGAAAAAACTTAGAGATTTTAAAAGATA ACATGCATGAGCTTCAATTAGGTTCTACTTATCCAGATTATGATAAGAATGCATATGATCTATATCAAGA TCATTTCTGGGATCCTGATACAAATAATAATTTCTCAAAGGATAATAGTTGGTATTTAGCTTATTCTATA CCTGACACAGGGGAATCACAAATAAGAAAATTTTCAGCATTAGCTAGATATGAATGGCAAAGAGGAAATT ATAAACAAGCTACATTCTATCTTGGAGAAGCTATGCACTATTTTGGAGATATAGATACTCCATATCATCC TGCTAATGTTACTGCCGTTGATAGCGCAGGACATGTTAAGTTTGAGACTTTTGCAGAAGAAAGGAAAGAA CAGTATAAAATAAACACAGTAGGTTGCAAAACTAATGAGGATTTTTATGCTGATATCTTAAAAAACAAAG ATTTTAATGCATGGTCAAAAGAATATGCAAGAGGTTTTGCTAAAACAGGGAAATCAATATACTATAGTCA TGCTAGCATGAGTCATAGTTGGGATGATTGGGATTATGCAGCAAAGGTAACTTTAGCTAACTCTCAAAAA GGAACAGCAGGATATATTTATAGATTCTTACACGATGTATCAGAGGGTAATGATCCATCAGTTGGAAATA ATGTAAAAGAACTAGTAGCTTACATATCAACTAGTGGTGAAAAAGATGCTGGAACAGATGACTACATGTA TTTTGGAATCAAAACAAAGGATGGAAAAACTCAAGAATGGGAAATGGACAACCCAGGAAATGATTTTATG GCTGGAAGCAAAGACACTTATACTTTCAAATTAAAAGATGAAAATCTAAAAATTGATGATATACAAAATA TGTGGATTAGAAAAAGAAAATATACAGCATTCCCAGATGCTTATAAGCCAGAAAACATAAAGGTAATAGC AAATGGAAAAGTTGTAGTTGACAAGGATATAAATGAGTGGATTTCAGGAAATTCAACTTATAATATAAAA TAATAAAAGTAAAAAAATAATTATTGGTTTTGGTGGTATTTACAAAATAAAAGCTT

If you need an N-term his tag you want to make a primer with a start (ATG) plus a 6xHis (e.g. CACCACCACCACCACCAT) plus some of the sequence that comes immediately after the very first ATG codon in the above bolded sequence (e.g. part of this: AAAAGAAAGATTTGTAAGGCGCTTGTTTGTGCCACG).  You may also need to add some extra bases prior to the ATG and the his tag for cloning into your pET vector.  This may be some dummy bases and a restriction site if you're doing ligation-based cloning (google for NEB's traditional cloning guide).  It may be sequence homologous to the cloning site of pET28+ for Gibson or some other chewback assembly technique.  Read the manual of those kits on how to make this sequence.  This extra sequence is indicated with X's below.

 

You'll end up with an N-term primer that looks something like this:

XXXXXXXXXXXXXXXXATGCACCACCACCACCACCATAAAAGAAAGATTTGTAAGGCGCTTG

For the part in bold and underlined you'll need to calculate an annealing temperature for your first PCR cycles.  You can add or subtract gene-specific homologous bases from it as necessary to get an appropriate annealing temperature.  Go to NEB, Thermo, or wherever for a Tm calculator appropriate to your polymerase.

 

For the 3' end of the gene you do the same, but you only need the pET28+ cloning sequence and the C-term sequence of the gene.  Tack them together like this: GGATATAAATGAGTGGATTTCAGGAAATTCAACTTATAATATAAAATAAXXXXXXXXXXXXXXX and then cut and paste into a program to generate the reverse complement sequence (google to find).  This reverse complement sequence will be what you order as an oligo, after you have modified the gene specific sequence to get an appropriate annealing temperature as above.

 

If you need a C-term his tag make your primers like this:

N-term primer: XXXXXXXXXXXXXXXXATGAAAAGAAAGATTTGTAAGGCGCTTG (notice that the ATG start codon is now part of the bold and underlined gene specific sequence, and the his tag is gone).

C-term primer: Reverse complement of: AGGAAATTCAACTTATAATATAAAACACCACCACCACCACCATTAAXXXXXXXXXXXXXXX (notice the the TAA stop codon is no longer part of the bold and underlined gene specific sequence, and there is a his tag between it and the rest of the ORF).

Do the same annealing temperature calculations on the gene specific portions of these primers.

 

Pro-tip: You can often increase the annealing temperature to be the annealing temperature (or 72C, whichever is less) of the total oligo (including the sequences which are not homologous to the gene you are PCRing) and get just as good, if not better, amplification.

 

I would try to clone your gene close to the RBS of the pET vector so that it will express well.  Or you can incorporate your own RBS into the N-term primer.

 

 

Note: I just noticed that pET28+ already has his tags in it.  You can clone directly into these his tag with the above sort of primer design procedures, but not including a his tag in the primer.  Beware of trying to clone using ligation into the NdeI site as your gene has an internal NdeI site.  This will not work.  If you clone it this way make sure your gene is missing the initial start codon (ATG) and is cloned in-frame to the start codon of the pET vector.  Your gene will be expressed as a fusion protein to the peptide that is already in the pET vector (which contains the his tags and contains a start ATG in the NcoI site).


Edited by 827753, 05 September 2016 - 12:07 AM.


#3 827753

827753

    member

  • Active Members
  • Pip
  • 17 posts
3
Neutral

Posted 04 September 2016 - 11:41 PM

Note to site admins!: I included a lot of URLs in my post above and some of these were deleted along with the trailing remainder of the text in the paragraph.  I can understand an anti-spam filter, but for someone who genuinely needs a lot of guidance this really did seem necessary.  I'm glad only a little bit of my text was deleted or I may not have been able to recover it from memory.



#4 Mashudu

Mashudu

    member

  • Active Members
  • Pip
  • 16 posts
0
Neutral

Posted 31 January 2017 - 05:25 AM

This by far, has been the BEST answer i expected, very well detailed and left me with no question to ask but just smile. Although i understood your detailed answer, the alpha toxin gene am cloning will be used as vaccine after successful expression. With that goal in mind, i am forced to amplify the whole gene and not just part of the gene (ORFs) to increase the immunogenicity of the vaccine in mice model. Am sure for this case the protocol is just the same as you detailed above. Tell me if i am wrong. Also, what would happen if i design primers with his-tag that is already in pET28a(+)? Will it not work?







Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.