Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

how to analysis the BiSearch ePCR result

BiSearch BSP MethPrimer

  • Please log in to reply
3 replies to this topic

#1 hawugeer

hawugeer

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 08 May 2015 - 04:50 AM

Hi everyone. I am a new person in epigenetic field. Now I planned to do BSP, and I designed the primer for BSP. I used the MethPrimer to design the primer and used Bisearch to check the primer. The result like this, and I do not understand why it also shows that "555 matches were found based on the 3' 16mer oligo search. Numeber of primer matches is over the limit (100). Only the first 100 matches are shown " Is this means that my primer is not specific?  Thanks in advance.

 
1.png

 

 

Attached Thumbnails

  • 1.png


#2 methylnick

methylnick

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 266 posts
6
Neutral

Posted 10 May 2015 - 01:58 PM

I haven't used methprimer for quite sometime now as I tend to design primers by eye and microsoft word.

 

However, methprimer express from ThermoFisher is still a free download and worth downloading and using, the primers selected are close to what I pick manually and are likely to work.

 

Because you are amplifying from bisulfite converted genome, there is a lot of degneracy induced and the complexity of the genome is reduced, all C's become U's and therefore T's after PCR. So it is no surprise your primer can hit many locations, it is the primer combination that will give amplification by PCR that you are interested in, therefore you want to get a specific product of expected size. That would be your readout....

 

Good luck!


All comments and communication are my own personal ones, and are not tied to any of my affiliations. 


#3 hawugeer

hawugeer

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 12 May 2015 - 01:04 AM

I haven't used methprimer for quite sometime now as I tend to design primers by eye and microsoft word.

 

However, methprimer express from ThermoFisher is still a free download and worth downloading and using, the primers selected are close to what I pick manually and are likely to work.

 

Because you are amplifying from bisulfite converted genome, there is a lot of degneracy induced and the complexity of the genome is reduced, all C's become U's and therefore T's after PCR. So it is no surprise your primer can hit many locations, it is the primer combination that will give amplification by PCR that you are interested in, therefore you want to get a specific product of expected size. That would be your readout....

 

Good luck!

 

Dear Nick,

 

Thanks for your quick reply. Then I think I do not have to worry those matches. And Could I ask some more questions? 

 

1. Based on your experience, what is the optimal product length? Is 200+bp OK?

 

2. If I have already have one target loci of the CpG, can I design a primer that only contain this CpG, and if there is difference then I could say that it is this loci that matters. For example, the DNA sequence below is the bisulfite modification DNA, the red is Forward and the Orange is Reverse, and the highlight yellow is the one that I interested. But I read an article and it suggests that more CpG is better in the product. But if so, how we can say which CpG that matter.

AGTTTTTATTTTTTTTGAAATGGAAAAAGGTGCGTGTATTGTGGAGGTATTAGAGTTTTTTAGAGTTTATATAGAGTTGTAAATTAGGTAGATATCGTCGAGAGTTAAGTTTTTCG

 

3. When the CpG can not be avoided in the primers, the methprimer software of the ThermoFisher will mismatch the C into R. Still take the example above: the Reverse sequence after bisulfite, contains 2 CpGs, and then the software design the Reverse primer like this: ACTTAACTCTCRACRATATCTACCTAA. How it works after the mismatch the C into R? 

 

Thanks a lot!!!

 

Best Wishes,

 

Yujie



#4 methylnick

methylnick

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 266 posts
6
Neutral

Posted 14 May 2015 - 01:16 PM

Hi Yujie,

 

1. Optimal length, this depends on what downstream assay you are using as readout, there is indication that the longer you go (up to 1kb) you start to get bias in the methylation readout, see PMID:17259213

 

2. I think you need to balance the cost of the assay against how many data points, CpG sites you want to look at. If that CG is what you are after, you might want to set your primer on the left hand side a little further away to reduce potential bias. 

 

3. Remember, bisulfite conversion generates non-complementary strands, so your primer pair actually targets on of those strands and not both. hence in the reverse primer you are getting R wobbles which are G/A, the reverse complement of the top strand of your sequence of interest. 

 

 

Good luck!


All comments and communication are my own personal ones, and are not tied to any of my affiliations. 






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.