Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Primer Designing


  • Please log in to reply
9 replies to this topic

#1 Burak Kaan Yasdı

Burak Kaan Yasdı

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 02 April 2015 - 10:13 AM

Can anyone design primers for me for IFNG interferon, gamma [Homo sapiens (human)] ? I tried to design but I couldnt desing :(



#2 pito

pito

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,363 posts
86
Excellent

Posted 02 April 2015 - 10:54 AM

what do you need exactly?

Whats the sequence of your gene?


If you don't know it, then ask it! Better to ask and look foolish to some than not ask and stay stupid.


#3 Burak Kaan Yasdı

Burak Kaan Yasdı

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 02 April 2015 - 12:46 PM

http://www.ensembl.o...ENST00000229135  this is the sequence of my gene . I tried to design it for 5 hours but i couldnt do it



#4 Burak Kaan Yasdı

Burak Kaan Yasdı

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 02 April 2015 - 12:51 PM

I need forward and reverse primers for amplification of needed gene,I need to calculate the specific temperature for these primers, 


Edited by Burak Kaan Yasdı, 02 April 2015 - 12:55 PM.


#5 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,299 posts
123
Excellent

Posted 03 April 2015 - 01:31 AM

What do you need the amplification for? Sequencing? Real-time detection? ...?

 

How exactly did you try to design the primers, what did you use?


Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

'Normal' is a dryer setting. - Elizabeth Moon


#6 Burak Kaan Yasdı

Burak Kaan Yasdı

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 03 April 2015 - 01:58 AM

I need these primers for PCR. Also I need to select right restriction enzymes for these primers.

First of all I used ncbi to find my cDNA sequence. After that primer3 helped me to find primers. Then from a site which is called restriction mapper, I tried to find restriction enzymes.


Edited by Burak Kaan Yasdı, 03 April 2015 - 02:06 AM.


#7 pito

pito

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,363 posts
86
Excellent

Posted 03 April 2015 - 02:26 AM

I need these primers for PCR. Also I need to select right restriction enzymes for these primers.

First of all I used ncbi to find my cDNA sequence. After that primer3 helped me to find primers. Then from a site which is called restriction mapper, I tried to find restriction enzymes.

So if I understand it completely: you want to amplify the gene (IFNG interferon, gamma) and add restriction sites to your primers?


If you don't know it, then ask it! Better to ask and look foolish to some than not ask and stay stupid.


#8 Burak Kaan Yasdı

Burak Kaan Yasdı

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 03 April 2015 - 03:14 AM

Yes you understood completely.



#9 pito

pito

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,363 posts
86
Excellent

Posted 03 April 2015 - 05:56 AM

Yes you understood completely.

ok

 

but what RE do you want to add?

 

I'll have a look later today to tell you how to design the general primers, then you already know that.


If you don't know it, then ask it! Better to ask and look foolish to some than not ask and stay stupid.


#10 pito

pito

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,363 posts
86
Excellent

Posted 05 April 2015 - 03:25 AM

For the primers: since you need a specific gene there is no real "problem" here.

You simple have to use the first 18bps (or 21-24) of the gene for the forward primer + the RE (and linker) you want to add.

For the reverse: exact the same, but in the other direction.

 

Simple put, lets say this is your gene:  TTTTTTTTTGGGGGGCCCCCAAAAGGGGGCCCCCC

 

You make the forward primer: TTTTTT

Reverse: GGGGG

(but in reality 18 bps long)

 

For the RE:

 

Forward:

 

XXXX-Linker-TTTTT

(from left to right 5'-3')

 

reverse:

YYYY-linker-GGGG

(from "right to left", 5'-3')

 

 

XXX = RE

YYY= RE

 

 

I have not had time to check it more in depth with your gene , but its the same approach...


If you don't know it, then ask it! Better to ask and look foolish to some than not ask and stay stupid.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.