Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

How to find amplicon sequence?

  • Please log in to reply
5 replies to this topic

#1 kabtq9s



  • Active Members
  • Pip
  • 9 posts

Posted 16 March 2015 - 06:22 PM

Among the many pieces of info that my teacher wants me to look up for a set of primers is the amplicon sequence (not amplicon size) is there a way to find it from the primer3 site?


I have the forward and reverse primer sequence and my target gDNA sequence


or do I have to figure it out manually ? for example for this alignment sequence



2161 aatgggcctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctg

2221 gtggtggccctggggatcggcctcttcatgcgaaggcgccacatcgttcggaagcgcacg

2281 ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct

2341 cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg

2401 ggctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt




Thanks in advance

Edited by kabtq9s, 16 March 2015 - 06:23 PM.

#2 bob1


    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,508 posts

Posted 17 March 2015 - 12:10 AM

But you have the sequence there....



Also, I've moved this to homework.

#3 kabtq9s



  • Active Members
  • Pip
  • 9 posts

Posted 17 March 2015 - 03:15 AM

This is the template sequence not the amplicon sequence.

#4 bob1


    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,508 posts

Posted 17 March 2015 - 11:53 AM

Yes, and... what do the primers delimit?

#5 kabtq9s



  • Active Members
  • Pip
  • 9 posts

Posted 18 March 2015 - 04:53 AM

The primers determine the location where the polymerase attaches and starts forming the new amplicon strand. I am guessing I have to write the complementary sequence of the amplicon strand according to the bases of the dna strand in order to find the amplicon sequence, I hope this is correct!

#6 bob1


    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 6,508 posts

Posted 20 March 2015 - 12:46 AM

I think you misunderstand a bit how PCR works. The amplicon sequence will be the same as the one you have above as only the forward primer gives you the complement of the sequence shown. The reverse primer will give you the sequence you see in your post above.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.