Among the many pieces of info that my teacher wants me to look up for a set of primers is the amplicon sequence (not amplicon size) is there a way to find it from the primer3 site?
I have the forward and reverse primer sequence and my target gDNA sequence
or do I have to figure it out manually ? for example for this alignment sequence
2161 aatgggcctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctg
>>>>>>>>>>>>>>>>>>>>
2221 gtggtggccctggggatcggcctcttcatgcgaaggcgccacatcgttcggaagcgcacg
2281 ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct
2341 cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg
<<<<<<<<<<<<<<
2401 ggctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt
<<<<<<
Thanks in advance
Edited by kabtq9s, 16 March 2015 - 06:23 PM.