5 replies to this topic

[kabtq9s]

Among the many pieces of info that my teacher wants me to look up for a set of primers is the amplicon sequence (not amplicon size) is there a way to find it from the primer3 site?

 

I have the forward and reverse primer sequence and my target gDNA sequence

 

or do I have to figure it out manually ? for example for this alignment sequence

 

 

2161 aatgggcctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctg
                    >>>>>>>>>>>>>>>>>>>>

2221 gtggtggccctggggatcggcctcttcatgcgaaggcgccacatcgttcggaagcgcacg


2281 ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct


2341 cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg
                                                                                     <<<<<<<<<<<<<<

2401 ggctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt
         <<<<<< 

 

 

 

Thanks in advance

Edited by kabtq9s, 16 March 2015 - 06:23 PM.

[bob1]

But you have the sequence there....

 

 

Also, I've moved this to homework.

[kabtq9s]

This is the template sequence not the amplicon sequence.

[bob1]

Yes, and... what do the primers delimit?

[kabtq9s]

The primers determine the location where the polymerase attaches and starts forming the new amplicon strand. I am guessing I have to write the complementary sequence of the amplicon strand according to the bases of the dna strand in order to find the amplicon sequence, I hope this is correct!

[bob1]

I think you misunderstand a bit how PCR works. The amplicon sequence will be the same as the one you have above as only the forward primer gives you the complement of the sequence shown. The reverse primer will give you the sequence you see in your post above.