Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

How to find amplicon sequence?


  • Please log in to reply
5 replies to this topic

#1 kabtq9s

kabtq9s

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 16 March 2015 - 06:22 PM

Among the many pieces of info that my teacher wants me to look up for a set of primers is the amplicon sequence (not amplicon size) is there a way to find it from the primer3 site?

 

I have the forward and reverse primer sequence and my target gDNA sequence

 

or do I have to figure it out manually ? for example for this alignment sequence

 

 

2161 aatgggcctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctg
                    >>>>>>>>>>>>>>>>>>>>

2221 gtggtggccctggggatcggcctcttcatgcgaaggcgccacatcgttcggaagcgcacg


2281 ctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagct


2341 cccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctg
                                                                                     <<<<<<<<<<<<<<

2401 ggctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagtt
         <<<<<< 

 

 

 

Thanks in advance


Edited by kabtq9s, 16 March 2015 - 06:23 PM.


#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,954 posts
433
Excellent

Posted 17 March 2015 - 12:10 AM

But you have the sequence there....

 

 

Also, I've moved this to homework.



#3 kabtq9s

kabtq9s

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 17 March 2015 - 03:15 AM

This is the template sequence not the amplicon sequence.



#4 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,954 posts
433
Excellent

Posted 17 March 2015 - 11:53 AM

Yes, and... what do the primers delimit?



#5 kabtq9s

kabtq9s

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 18 March 2015 - 04:53 AM

The primers determine the location where the polymerase attaches and starts forming the new amplicon strand. I am guessing I have to write the complementary sequence of the amplicon strand according to the bases of the dna strand in order to find the amplicon sequence, I hope this is correct!



#6 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,954 posts
433
Excellent

Posted 20 March 2015 - 12:46 AM

I think you misunderstand a bit how PCR works. The amplicon sequence will be the same as the one you have above as only the forward primer gives you the complement of the sequence shown. The reverse primer will give you the sequence you see in your post above.






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.