Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

pcr primer design


  • Please log in to reply
6 replies to this topic

#1 mapper

mapper

    member

  • Members
  • Pip
  • 1 posts
0
Neutral

Posted 09 March 2015 - 11:02 PM

hi, i'm new to pcr primer designing using softwares.I want to synthesize 2 primers for a protein coding gene which is to be inserted in to pcambia vector. can anybody tell me where can I get a stepwise procedure to design primers for standard pcr using bioedit or primer3 etc? 

Thank you



#2 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,298 posts
123
Excellent

Posted 19 March 2015 - 06:07 AM

I found this one for example on google, searching for "how to use primer3".


Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

'Normal' is a dryer setting. - Elizabeth Moon


#3 aldoskys

aldoskys

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 20 March 2015 - 12:00 AM

TGCAGGCGCCCCGAGTGCTGC
CGTCACTAGTGTCGTCTACTA
Dear      I want to know how this gentleman  calculated the Tm of the F 73 and 54 for the R primers  because I used the Wallace Rule it gives F 74 and R 62 C. in this case the Ta should be around 55-65.
thank you

 


Edited by aldoskys, 20 March 2015 - 12:05 AM.


#4 Trof

Trof

    Brain on a stick

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,298 posts
123
Excellent

Posted 20 March 2015 - 11:34 AM

Which gentleman exactly? In primer3 you can select Table of thermodynamic parameters and Salt correction formula depending on prefered paper. Also adjusting the salt concentrations.

But I don't adjust anything and use default values, it gives pretty good estimate for annealing temperature using the calculated Tm -4 degrees.

 

But what did you expect? You have one primer with 76% GC and the other one with 47 and they are of same length. And still you have too much Tm difference between primers, regardless what formula you use..


Our country has a serious deficiency in lighthouses. I assume the main reason is that we have no sea.

I never trust anything that can't be doubted.

'Normal' is a dryer setting. - Elizabeth Moon


#5 aldoskys

aldoskys

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 21 March 2015 - 04:11 PM

I have these two primers F: TCAAAGGAATGTTGGG  and R: ACGCACATAGGGATTG to use in PCR. I want to know what is the Tm for the two primers in order to know what annealing temperature to be used while running the PCR. 

I will be using this buffer 10X ViBuffer A (without MgCl2} 500mM KCl, 100mM Tris-HCI (PH 9.1 at 20°C) and 0.1 % Triton™ X-100. The buffer is optimized for use with 0.1-0.2mM of each dNTP. where the primers concentration is 2um.and the MgCl2 is 50mM.

Please I need some help with these two primers F: TCAAAGGAATGTTGGG  and R: ACGCACATAGGGATTG . Any help is really appreciated I have calculate Tm using Wallace rule

Tm = 4(G+C) + 2(A+T)  Tm Forward primer = 46 C  and for Reverse =50 C. In addition to that I used online Tm calculator at

 

thank you very much,

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Please need some help

 

 

 



#6 Mad researcher

Mad researcher

    Newbie !!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 111 posts
7
Neutral

Posted Yesterday, 03:14 PM

I have these two primers F: TCAAAGGAATGTTGGG  and R: ACGCACATAGGGATTG to use in PCR. I want to know what is the Tm for the two primers in order to know what annealing temperature to be used while running the PCR. 

I will be using this buffer 10X ViBuffer A (without MgCl2} 500mM KCl, 100mM Tris-HCI (PH 9.1 at 20°C) and 0.1 % Triton™ X-100. The buffer is optimized for use with 0.1-0.2mM of each dNTP. where the primers concentration is 2um.and the MgCl2 is 50mM.

Please I need some help with these two primers F: TCAAAGGAATGTTGGG  and R: ACGCACATAGGGATTG . Any help is really appreciated I have calculate Tm using Wallace rule

Tm = 4(G+C) + 2(A+T)  Tm Forward primer = 46 C  and for Reverse =50 C. In addition to that I used online Tm calculator at

 

thank you very much,

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Please need some help

 

 

 

 

Use this website to calculate/estimate the annealing temp. of your primers

 

http://www.basic.nor.../oligocalc.html


Cheers,

Mad Researcher

#7 Mad researcher

Mad researcher

    Newbie !!

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 111 posts
7
Neutral

Posted Yesterday, 03:15 PM

hi, i'm new to pcr primer designing using softwares.I want to synthesize 2 primers for a protein coding gene which is to be inserted in to pcambia vector. can anybody tell me where can I get a stepwise procedure to design primers for standard pcr using bioedit or primer3 etc? 

Thank you

 

Hi,

Maybe this would help you. Its based on primer3 plus.

 

bit.ly/1GQ0T5P

 

Cheers


Cheers,

Mad Researcher




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.