Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

How can I check the quality of bacterial primers and their specificity on blast?

pcr BLAST PRIMERS

  • Please log in to reply
1 reply to this topic

#1 mer

mer

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 12 February 2015 - 02:50 AM

I found in articles primers specific to different strains eg: Akkermancia muciniphila ,Bacteroides vulgatus... I noticed that many people still check these primers on blast to ensure their qualities and their specificities. Who can give me the steps to follow on to check primers on blast tool? I give you an example (Enterobacteriaceae)

EntF: 5'CATTGACGTTACCCGCAGAAGAA3'
EntR: 5'CGCTTGCACCCTCCGTATTA3'

 

Thanks



#2 5280

5280

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 107 posts
7
Neutral

Posted 01 March 2015 - 07:18 PM

Just paste the primer sequences into primer blast (http://www.ncbi.nlm....s/primer-blast/) then select the bacteria species you are trying to test them against. You will get a readout for potential off-targets, etc. 







Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.