Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Changing the vector

cloning

  • Please log in to reply
55 replies to this topic

#16 Bio-Lad

Bio-Lad

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 85 posts
16
Good

Posted 11 August 2014 - 06:56 PM

You will definitely need to linearize the vector at the same (or compatible) sites that you are using in your PCR-amplified product.  If you don't, you won't be able to ligate the fragment in.  If you need more detailed help, perhaps you can post (or PM) the sequence you wish to clone and the vector in which you wish to put it.  As for making point mutations, there are several ways to go about it including the kits below:

 

https://www.neb.com/...mutagenesis-kit

http://www.lifetechn...utagenesis.html

http://www.thermosci...utagenesis-kit/


Try pLOT, the a free plasmid mapping tool!

http://plasmidplotter.blogspot.com/


#17 RNA woman

RNA woman

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 44 posts
0
Neutral

Posted 11 August 2014 - 11:38 PM

Thank You Bio-lab. I attached the GOI and I want to clone it in pTRE3G vector. If you can help me with that it will be great. My main concern is to introduce sequence that fit to the MCS of the vector to the primers. I am not confident in doing this.

atgcgaccctccgggacggccggggcagcgctcctggcgctgctggctgcgctctgcccggcgagtcgggctctggaggaaaagaaagtttgccaaggcacgagtaacaagctcacgcagttgggcacttttgaagatcattttctcagcctccagaggatgttcaataactgtgaggtggtccttgggaatttggaaattacctatgtgcagaggaattatgatctttccttcttaaagaccatccaggaggtggctggttatgtcctcattgccctcaacacagtggagcgaattcctttggaaaacctgcagatcatcagaggaaatatgtactacgaaaattcctatgccttagcagtcttatctaactatgatgcaaataaaaccggactgaaggagctgcccatgagaaatttacaggaaatcctgcatggcgccgtgcggttcagcaacaaccctgccctgtgcaacgtggagagcatccagtggcgggacatagtcagcagtgactttctcagcaacatgtcgatggacttccagaaccacctgggcagctgccaaaagtgtgatccaagctgtcccaatgggagctgctggggtgcaggagaggagaactgccagaaactgaccaaaatcatctgtgcccagcagtgctccgggcgctgccgtggcaagtcccccagtgactgctgccacaaccagtgtgctgcaggctgcacaggcccccgggagagcgactgcctggtctgccgcaaattccgagacgaagccacgtgcaaggacacctgccccccactcatgctctacaaccccaccacgtaccagatggatgtgaaccccgagggcaaatacagctttggtgccacctgcgtgaagaagtgtccccgtaattatgtggtgacagatcacggctcgtgcgtccgagcctgtggggccgacagctatgagatggaggaagacggcgtccgcaagtgtaagaagtgcgaagggccttgccgcaaagtgtgtaacggaataggtattggtgaatttaaagactcactctccataaatgctacgaatattaaacacttcaaaaactgcacctccatcagtggcgatctccacatcctgccggtggcatttaggggtgactccttcacacatactcctcctctggatccacaggaactggatattctgaaaaccgtaaaggaaatcacagggtttttgctgattcaggcttggcctgaaaacaggacggacctccatgcctttgagaacctagaaatcatacgcggcaggaccaagcaacatggtcagttttctcttgcagtcgtcagcctgaacataacatccttgggattacgctccctcaaggagataagtgatggagatgtgataatttcaggaaacaaaaatttgtgctatgcaaatacaataaactggaaaaaactgtttgggacctccggtcagaaaaccaaaattataagcaacagaggtgaaaacagctgcaaggccacaggccaggtctgccatgccttgtgctcccccgagggctgctggggcccggagcccagggactgcgtctcttgccggaatgtcagccgaggcagggaatgcgtggacaagtgcaaccttctggagggtgagccaagggagtttgtggagaactctgagtgcatacagtgccacccagagtgcctgcctcaggccatgaacatcacctgcacaggacggggaccagacaactgtatccagtgtgcccactacattgacggcccccactgcgtcaagacctgcccggcaggagtcatgggagaaaacaacaccctggtctggaagtacgcagacgccggccatgtgtgccacctgtgccatccaaactgcacctacggatgcactgggccaggtccctaagatcccgtccatcgccactgggatggtgggggccctcctcttgctgctggtggtggccctggggatcggcctcttcatgcgaaggcgccacatcgttcggaagcgcacgctgcggaggctgctgcaggagagggagcttgtggagcctcttacacccagtggagaagctcccaaccaagctctcttgaggatcttgaaggaaactgaattcaaaaagatcaaagtgctgggctccggtgcgttcggcacggtgtataagggactctggatcccagaaggtgagaaagttaaaattcccgtcgctatcaaggaattaagagaagcaacatctccgaaagccaacaaggaaatcctcgatgaagcctacgtgatggccagcgtggacaacccccacgtgtgccgcctgctgggcatctgcctcacctccaccgtgcaactcatcacgcagctcatgcccttcggctgcctcctggactatgtccgggaacacaaagacaatattggctcccagtacctgctcaactggtgtgtgcagatcgcaaagggcatgaactacttggaggaccgtcgcttggtgcaccgcgacctggcagccaggaacgtactggtgaaaacaccgcagcatgtcaagatcacagattttgggctggccaaactgctgggtgcggaagagaaagaataccatgcagaaggaggcaaagtgcctatcaagtggatggcattggaatcaattttacacagaatctatacccaccagagtgatgtctggagctacggggtgaccgtttgggagttgatgacctttggatccaagccatatgacggaatccctgccagcgagatctcctccatcctggagaaaggagaacgcctccctcagccacccatatgtaccatcgatgtctacatgatcatggtcaagtgctggatgatagacgcagatagtcgcccaaagttccgtgagttgatcatcgaattctccaaaatggcccgagacccccagcgctaccttgtcattcagggggatgaaagaatgcatttgccaagtcctacagactccaacttctaccgtgccctgatggatgaagaagacatggacgacgtggtggatgccgacgagtacctcatcccacagcagggcttcttcagcagcccctccacgtcacggactcccctcctgagctctctgagtgcaaccagcaacaattccaccgtggcttgcattgatagaaatgggctgcaaagctgtcccatcaaggaagacagcttcttgcagcgatacagctcagaccccacaggcgccttgactgaggacagcatagacgacaccttcctcccagtgcctgaatacataaaccagtccgttcccaaaaggcccgctggctctgtgcagaatcctgtctatcacaatcagcctctgaaccccgcgcccagcagagacccacactaccaggacccccacagcactgcagtgggcaaccccgagtatctcaacactgtccagcccacctgtgtcaacagcacattcgacagccctgcccactgggcccagaaaggcagccaccaaattagcctggacaaccctgactaccagcaggacttctttcccaaggaagccaagccaaatggcatctttaagggctccacagctgaaaatgcagaatacctaagggtcgcgccacaaagcagtgaatttattggagcatga



#18 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,794 posts
406
Excellent

Posted 12 August 2014 - 12:13 AM

Your specific forward primer will be the first 20-25 bp of the sequence you posted above. The reverse primer will be the reverse complement of the last 20-25 bp.  To the 5' end of each of these you need to add a restriction site, and 5' of that 6 bp to allow the RE to bind.

 

So your forward primer might look like this for incorporation of a BglII site (bp 7-12):

 

GGGCCC AGATCT atgcgaccctccgggacggc

 

Depending on what want to do you might want to add a Shine-Delgarno sequence (for bacterial expression) or a Kozak sequence (mammalian expression) immediately before the ATG. E.g. for a Kozak if would look like this GGGCCC AGATCT GCCACCatgcgaccc...etc.  However, these aren't necessary, but can help in some circumstances.



#19 Bio-Lad

Bio-Lad

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 85 posts
16
Good

Posted 12 August 2014 - 10:02 AM

OK this will be a little bit long-winded.  Sorry.  here goes
 
So first things first, you need to check which of the sites in the destination vector (and thus which sites you will adding to your primers) are NOT in the sequence itself.  If they are then you will be cutting your gene of interest at the same time as you digest the sites in your primer ends (which is bad).  In this case, you have the following enzymes present (see Fig. 1 graphicy thing): EagI, PstI, BamHI, ApaI, NdeI and ClaI.  Meaning that you can only use the following: NheI, EcoRV, SalI, and MluI.
 
Fig. 1
HLAB9bT.jpg
 
Step II:
Next best step is to plan ahead.  You’ll want to do a double digest (with the enzymes whose sites are put into your primers) so it helps if you see which of the available enzymes are compatible buffer-wise (NEB has an app that lets you find this or you can find it online.  If you are using another vendor, this info should be available for their products as well).   In your case, I took NheI (NEB# R3131S) and EcoRV (R3195S) because both come from NEB in the “High Fidelity” form that use the same buffer.

 
Step III:
Now you’re going to make your primers.  In this case the sequence is somewhat chosen for you since you need the whole thing.  HOWEVER, your sequence that you gave starts at the ATG (start codon) of your GOI.  This means that your PCR fragment will lack the Kozak sequence needed to start transcription.  You want this section of your primers to be 20+bp (as Bob mentioned).  I took the first 20 because the Tm (which will be used in your PCR) is already pretty high at 68C.  Then you add a Kozak consensus sequence (italics) and the restriction site (underlined).  EcoRV will go on the forward primer and NheI on the reverse so that when you ligate, your EGFR goes into the vector in the correct orientation.  In this case, I will use the endogenous Kozac (lowercase, italics) as part of the primer.  This will be your Fwd_Primer.
               
The reverse primer, I took ~30 to as to try to match the Tm a bit at 62C.  The second has more As and Ts in that region, which is why the Tm is so low.  Remember that this is going to be the reverse strand sequence.  The gene-specific part is uppercased below.  Then you have to add the site you want to use so the NheI is on the left (uppercase and underlined).
 
On both, add a few spacer bases so the enzymes can cut efficiently.
 
Fwd_Primer: gggggg GATATC cggggagcagcg ATGCGACCCTC    Tm = 69C
Rev Primer:  gggggg CATATG  TCATGCTCCAATAAATTCACTGCTTTGTGG   Tm = 62C
 
Last step:
After you PCr and clone this, sequence, sequence, sequence!   Your sequence has a LOT of repeat elements in it which may be incorrectly copied (see Fig. 2 graphicy thing), even by high fidelity polymerases so you will want do design sequencing primers within the EGFR so that you can sequence the whole thing!
 
Fig. 2
CI6xBV3.jpg


Edited by Bio-Lad, 12 August 2014 - 10:13 AM.

Try pLOT, the a free plasmid mapping tool!

http://plasmidplotter.blogspot.com/


#20 RNA woman

RNA woman

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 44 posts
0
Neutral

Posted 13 August 2014 - 12:08 AM

Oh! Thank you guys really for explaining so clearly. I would never know by myself about the kozac sequences and stuff like that! 



#21 Bio-Lad

Bio-Lad

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 85 posts
16
Good

Posted 13 August 2014 - 03:04 AM

Feel free to ask any other questions you have down the line. :)

Try pLOT, the a free plasmid mapping tool!

http://plasmidplotter.blogspot.com/


#22 RNA woman

RNA woman

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 44 posts
0
Neutral

Posted 19 August 2014 - 08:42 PM

Hello again,

questions here,

1-does all the primers need to have 5' phosphate group? 

2- At which stage I need to sequence, after amplify the gene, after cloning the gene into the new vector or later after making the point mutation?

Sorry if questions sound very naive but I don't have even chart for the cloning experiment yet. All I need is the final mutated cell line to start my spectroscopy analysis!


Edited by RNA woman, 19 August 2014 - 11:56 PM.


#23 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,794 posts
406
Excellent

Posted 20 August 2014 - 12:29 AM

In general if you are going to digest the PCR product, then you don't need to 5' phosphorylate the primers. If you were doing something like Qickchange then I would say it might be better if you did have the phosphates.

 

I would sequence once you have it inserted into the new vector. You will also need to sequence after the site directed mutagenesis, so that you can confirm the presence of the point mutation.



#24 RNA woman

RNA woman

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 44 posts
0
Neutral

Posted 26 August 2014 - 06:36 PM

Hi again which competent cell kit to order for heat shock protocol ?



#25 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,484 posts
251
Excellent

Posted 26 August 2014 - 06:41 PM

There are many choices. Our standard competent cells are NEB10B cells, a version of DH10B, but many others would be suitable. You can also make good ones yourself here:

http://openwetware.o...competent_cells



#26 RNA woman

RNA woman

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 44 posts
0
Neutral

Posted 26 August 2014 - 06:47 PM

what about Top10. I found it already in our freezer ?



#27 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,484 posts
251
Excellent

Posted 26 August 2014 - 06:49 PM

It's essentially the same as DH10B or NEB10B.



#28 Bio-Lad

Bio-Lad

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 85 posts
16
Good

Posted 26 August 2014 - 06:51 PM

Do you have access to an electroporator? If so, I would suggest making electro competent cells. They are easier to make (for me anyway), require no extra chemicals other than 10% glycerol and tend to give better efficiencies. The down side is you have to either dilute or purify your ligation before transforming so it doesn't blow up on you (arc) but that's all I use.

Try pLOT, the a free plasmid mapping tool!

http://plasmidplotter.blogspot.com/


#29 Bio-Lad

Bio-Lad

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 85 posts
16
Good

Posted 26 August 2014 - 06:52 PM

Or yeah, you can use ones you already have :-P

Try pLOT, the a free plasmid mapping tool!

http://plasmidplotter.blogspot.com/


#30 RNA woman

RNA woman

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 44 posts
0
Neutral

Posted 28 August 2014 - 06:49 PM

I have more questions:

what after ligation  GOI to the open vector can I sequence directly or i should transfer it to e-cloi amplify the plasmid before sequencing?







Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.