Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo

could you help me with my stem loop RT primer?


  • Please log in to reply
1 reply to this topic

#1 superice

superice

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 25 June 2014 - 06:55 AM

I use U6 as internal control, and i found U6 sequence :

GUGCUCGCUU CGGCAGCACA UAUACUAAAA UUGGAACGAU ACAGAGAAGA UUAGCAUGGC CCCUGCGCAA GGAUGACACG CAAAUUCGUG AAGCGUUCCA UAUUUU

And i design the stem loop RT primer like this :GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA

and I use this three pairs of pimer to do the qPCR (SYBR GREEN )

 
U6 F1  CTCGCTTCGGCAGCACA
U6 R1  AACGCTTCACGAATTTGCGT
 
 
U6 F2:GCGCGT CGTGAAGCGTTC
U6 R2: GTGCAGGGTCCGAGGT
 
U6 F3: CGG GTGCTCGCTTCGGCAG
U6 R3: ATCCAGTGCAGGGTCCGAGG
 
But it could not be amplified. 
 
The stem loop RT primer had been re-fold. And I have try different reverse transcriptase condition like 65℃ 10mins 42℃ 30mins or 16℃ 30mins 42℃30mins or 30℃ 10mins 42℃ 30mins. both of them do not work.
 
Could you please give me some suggestion? thank you


#2 superice

superice

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 25 June 2014 - 06:57 AM

the qpcr condition is    95℃ 15s  60℃ 40s  40cycle thanks






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.