Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

In vitro transcription not working

  • Please log in to reply
No replies to this topic

#1 Ahrenhase

  • Awaiting Authorisation
  • PipPipPipPipPipPipPipPipPipPip
  • 196 posts

Posted 01 June 2014 - 01:53 PM

I'm trying to perform T7 polyermase mediated IVT using ambion's mMEssage IVT kit (am1344).  I have performed this in the past quite frequently using digest plasmid; however, now I'm trying to use a ~140 bp PCR product (2pmol or 136ng) with the T7 promoter (TAATACGACTCACTATAGGG) attached to the 5' end.  My yields are very poor (<1ug) and when I run out on a gel, I don't see any bands.  Is the promoter I'm using sufficient?

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.