Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Bisulfite/sequencing-based Methylation Analysi


  • Please log in to reply
14 replies to this topic

#1 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 07 April 2014 - 05:56 PM

I recently designed different set of primers using the online Epidesiger and the Zymo Bisulfite primer seeker. The annealing tempretures came between 50 to 55. I used the EpiTect kit. DNA fragments I am intoregating ranging from 237 to 549 bp. I am trying to make my PCR conditions work. But I got nothing on the gel! Nothing! Not even a smeer. I tried PCR volumes 25 ul and 50 ul with no luck. I am sure I am using 10 uM primers to final concentration 0.8 to 1.0 uM.
I am using the 2X mean green master mix. Other folks in the lab didn't have problem with the use of this master mix. I don't know why the gel has nothing!

#2 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,410 posts
234
Excellent

Posted 08 April 2014 - 05:16 AM

Try lowering your extension temperature from 72 to 64 and lengthening your extension time by 50%. Very low GC DNA will not extend at 72 in many PCR reactions. I assume you already have tried lowering the annealing temperature. It's worth trying as low as 48, but I've never gotten anything to work below that. Do NOT believe the calculated Tm for use in your PCR annealing temperature.



#3 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 08 April 2014 - 08:19 AM

Thanks Phage434!

Lots of folks are saying that the EpiTect kit is very reliable. Do I need to worry about the use of the mean green master mix I used? Do you think it may hurts the bisulfited DNA?

I planning to make my own regular master mix I used to use before. How about the cycles number? do you think 35 is good enough?

Thanks



#4 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 08 April 2014 - 08:58 AM

In most cases, 35 cycles are not enough. Are you doing MSP or BSP? If it is for BSP, you can reamplify your first round products.  



#5 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,410 posts
234
Excellent

Posted 08 April 2014 - 09:27 AM

One thing I discovered is that bisulfite conversion of uncut plasmid DNA is very poor. You need to linearlize plasmids if you want to see conversion. Usually this is not an issue, since you care about genomic DNA, not plasmid DNA, but it is something to know about.

I agree that 40 cycles would be prudent in this case.



#6 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 08 April 2014 - 09:32 AM

Thanks folks!

I will be doing bisulfite-sequencing PCR. I am using genomic DNA not plasmid circular DNA. Thanks for the tip though. I will try 40 cycles. The problem is that we do not have a thermocycler that enables a gradient-change of temperatures to make life easier for catching the right annealing temp. So I guess I have to be lucky to get the right Annealing Temp sooer :)  



#7 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 08 April 2014 - 09:34 AM

In most cases, 35 cycles are not enough. Are you doing MSP or BSP? If it is for BSP, you can reamplify your first round products.  

so I clean my PCR products and run another PCR using the same primers?



#8 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,410 posts
234
Excellent

Posted 08 April 2014 - 09:44 AM

You don't have to clean your former reaction. Just add a very small amount of the previous reaction as a template to the new one.



#9 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 08 April 2014 - 11:15 AM

Thanks!
What's the advantage for that?

#10 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,410 posts
234
Excellent

Posted 08 April 2014 - 12:30 PM

You're effectively doing more cycles on the previous reaction. You don't want all of the reaction components of the previous PCR in your new reaction, just a little template DNA, so you want to dilute the previous reaction. If you dilute by 100x, then an additional 7 cycles will get you back to where you were. From there, you amplify more.



#11 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 09 April 2014 - 06:34 PM

I decreased the extension temp to 65 for 90'' and last extension for 20 minutes. Still no Products, no smeer! I also increased the cycles number to 40.

#12 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,410 posts
234
Excellent

Posted 10 April 2014 - 07:51 AM

Have you tried lowering your annealing temperature? This is the first thing to try if you are getting no amplification, and I asked previously if you had tried it.



#13 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 10 April 2014 - 07:54 AM

Yes I did. I used to lower Ann Temp. 50 and 55.
The scary thing is that I didn't see smeer down the gel?

#14 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 10 April 2014 - 07:56 AM

I am sure I am adding the templates, primers and dNTPs!!
Why no smeer even?!

#15 Epigenome1

Epigenome1

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 10 April 2014 - 10:02 AM

This is the DNA fragment I am interrogating:

CATAAGAGACGCCCTCAAAACACTATGACTTTTATTAGTTATTCACCTCCCCAGAGCTGTCCCTGGATACAGACAACATAGGTATGAGGTAGGGGGTACGTGGAGCCAAACAGGAGGTAATACCTTCTGAATTTAGATGCTAACAAGAAAACATGGGGAAAGGTGGCCCAGATACACTAGGCCCTTTATTCTTTGGGCCTGTAACACCTACTTATTTGATTGTGGCATGAACCATGAACTCGGTTTGGGGCAAGTCCTTCCTTTTTCTGCAGTCTGTGGAATCGGGAGAGGTTAGCCATTGCCGCCTCTATTCACCTTAGGCATGATGTAAACAGAAATTAGTATCTCTGCCTCCTTCCTTTTTCCACACCCCGAAGTCATTTCCTCTTAACCTGGGATTTCGACGTCTATATTCCCTCTGTATGATAGATGCACTCAGGGAGGCAAGGGGGGGAGGGAGGAACTTCTTAAAATTCCCCCAGAATGTTTTGACACTAGTTTTCAGTGTTGCAATTGAGACTAGTCAGTTTCTACTTTGGGTTTCCATCAGAAAGTTCTGTAGGAGTAGAGTATATAAGCACCAGGAGCAGCCAAGGCAGCAGAAGGAACAGTGGGTGTCCAGGCACATCAGACCAGGCAGCTCGCAGCAAAGCAAGGTAAGTTCTCTCCTCTTCCCTGTCGCTAACTCCCTGCATCTAGAGGCTGTCCAGATTCAGACTCCAGGGGACAGGCTACCCCTGAACCAGGCAGCGTGGGAGTGGGGTAAGTGGATTCTGGGAG

Left primer: 

5'-TGGAGTTAAATAGGAGGTAATATTTTTTG-3'

 

Right primer:

5'-CCCCTTACCTCCCTAAATACATCT-3'




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.