Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Sequencing of ~3,5 kb


  • Please log in to reply
11 replies to this topic

#1 tretol

tretol

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 30 posts
1
Neutral

Posted 28 December 2013 - 01:05 AM

Hello,
i would linke to sequence the whole rpoB gene. But how can I do it?
Should I divide the gene into smaller regions, do pcr and sequencing separately?

For example Khamis, Raoult and La Scola (2004) have a set of primers for rpoB.

b1hh.jpg

 

How can I now select the best primers for my purpose? I thought about following pairs:

 

1) C35F and C1415F

2) C890F and C2130R

3) C1415F and C2700R

4) C2130F and C3490R

5) C2625F and C3490R

 

For sequencing I am planing to only use the forward primers.

Please let me know your suggestions. Many thanks!


Edited by tretol, 28 December 2013 - 05:55 AM.


#2 mdfenko

mdfenko

    an elder

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 2,781 posts
132
Excellent

Posted 30 December 2013 - 05:04 AM

what method are you using to sequence?

 

if next gen then you will make a library, run and construct your gene (i'm not fully versed on ngs so i can't give more detail).

 

if sanger sequencing then you can primer-walk (use several primers which will give overlapping sequence for you to construct the gene.


talent does what it can
genius does what it must
i do what i get paid to do

#3 tretol

tretol

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 30 posts
1
Neutral

Posted 02 January 2014 - 11:43 AM

Hello,

it is Sanger sequencing. Then, I will use overlapping sequences. I am planning to use the following primers:

 

C35F  

GGAAGGACCCATCTTGGCAGT

C1415R

GVGTGATGCCKGCRTACAC

 

C820F

CCYGCRACGAACGCCATCT

C2130R

GTGGCCYTCCCAHGGCATGAA

 

C1415F

CBCACTACGGMCGYATGTG

C2700R

GCWTACTTGTARCCVGTCCA

 

 

C1415F

CBCACTACGGMCGYATGTG

C2700R

GCWTACTTGTARCCVGTCCA

 

C2625F

AGATCCARGAYGGCGAYAAG

C3490R

GCWTACTTGTARCCVGTCCA

 

 

Could you please help with primer quality estimation (information about whether dimers or secondary structures will be formed)?

I used 'Primer List' program on this web page: http://primerdigital.com/tools/

Unfortunately, because I am not sufficiently experienced, I cannot draw the conclusion.


Edited by tretol, 02 January 2014 - 11:53 AM.


#4 mdfenko

mdfenko

    an elder

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 2,781 posts
132
Excellent

Posted 02 January 2014 - 12:15 PM

since you are sequencing you won't have to worry about dimers, you use only one primer in each reaction.

 

there are a number of primer design tools available online (you can google them) or you can use the primers that were already designed and walk from both ends.


talent does what it can
genius does what it must
i do what i get paid to do

#5 Angeline

Angeline

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 16 January 2014 - 04:12 AM

Hi. Im also planning to use the overlapping sequences to sequence a 20 kb length product.

Say if I have 20 primer sets for that with 150 bp overlapping. What would be the more appropriate way to prepare my sample for sequencing?

Do I need to optimize all the primer sets? 



#6 mdfenko

mdfenko

    an elder

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 2,781 posts
132
Excellent

Posted 16 January 2014 - 04:48 AM

Hi. Im also planning to use the overlapping sequences to sequence a 20 kb length product.

Say if I have 20 primer sets for that with 150 bp overlapping. What would be the more appropriate way to prepare my sample for sequencing?

Do I need to optimize all the primer sets? 

when sequencing you don't use primer "sets". you use only one primer in each reaction. a "reverse" primer can be used in a separate reaction to sequence from the other end and/or to confirm the results of the "forward" primer.


talent does what it can
genius does what it must
i do what i get paid to do

#7 Angeline

Angeline

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 17 January 2014 - 06:27 PM

I see. 

If my initial sample is in RNA form, then I have to convert them to cDNA. After that, I can sequence directly using the cDNA as template and the forward primers? 



#8 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,467 posts
247
Excellent

Posted 17 January 2014 - 06:34 PM

You would normally need to amplify the cDNA by PCR prior to sequencing. The primers used for PCR will determine which RNA (really cDNA) is amplified and then sequenced. You'll need primer pairs for the PCR, but after the PCR and product purification, you will sequence with only one of those primers (or with both in separate reactions).



#9 Angeline

Angeline

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 17 January 2014 - 06:47 PM

Thanks for the reply.

In that case, I have to have another primer pairs for the PCR? For the PCR, do I need to amplify the whole 20kb lenght? 



#10 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,467 posts
247
Excellent

Posted 17 January 2014 - 07:28 PM

You can use the one of the PCR primers in a sequencing reaction, so no, you need only the PCR primers.

You don't need to PCR the entire cDNA (it would be difficult in any case -- normally the cDNAs are shorter than that, since the RT reaction has difficulty with long transcripts).



#11 mdfenko

mdfenko

    an elder

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 2,781 posts
132
Excellent

Posted 18 January 2014 - 04:32 PM

although i have done it successfully, using the same primers as for the pcr used to amplify the dna may not work. you should prepare a primer starting a few bases in from the end.


talent does what it can
genius does what it must
i do what i get paid to do

#12 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,467 posts
247
Excellent

Posted 18 January 2014 - 08:30 PM

Using PCR primers for sequencing is only a problem if your PCR reaction produces multiple bands or primer dimer products. If you have a good single band, then a PCR primer works well for sequencing. But, as mdfenko says, making a second primer interior to the PCR primer will largely solve this problem, so that you can sequence with relatively impure PCR product.






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.