Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

primer checking & restriction enzyme based methylation specific polymerase c

primer

  • Please log in to reply
8 replies to this topic

#1 whitehorse25

whitehorse25

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 24 December 2013 - 12:42 AM

Dear doctor,

I want to check a primer sequence in promoter area of two genes for methylaion analysis:

BRCA1 gene:

forward:

5' TTGGGAGGGGGCTCGGGCAT 3'

Reverse:

5' CAGAGCTGGCAGCGGACGGT 3'

17-Beta Hydroxysteroid dehydrogenase type 1:

Forward:

5'AGACCATCCTCACCAACAGG 3'

Reverse:

5'CCTGGCCCTGTCATTTTTAG 3'

 

I tried to find them in blast and ensembl, but :

in blast I found but I donot know their position in promoter or not

in ensemble:

I found the forward only( BRCA-1 in area not exon may promoter???) ( in 2nd gene in exon)

please tell me " Is that primers right or not and to do they donot give the result I want in methylation analysis using resriction enzyme?"

If that primer is wrong, so what is the solution?

thanks alot 



#2 memari

memari

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 148 posts
11
Good

Posted 24 December 2013 - 10:21 AM

Places of primers:

 

http://i42.tinypic.com/mt40na.jpg

 

These are not good primers

 

http://genome.ucsc.e...p_flipReverse=0

 

 

http://genome.ucsc.e...p_flipReverse=0


-----
Babak Memari

#3 memari

memari

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 148 posts
11
Good

Posted 24 December 2013 - 12:13 PM

sorry I made a mistake:

 

this is the results of primer blast

 

http://genome.ucsc.e...p_flipReverse=0

 

http://genome.ucsc.e...p_flipReverse=0


-----
Babak Memari

#4 whitehorse25

whitehorse25

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 25 December 2013 - 01:48 PM

thank you for your reply

but:

these primer in promoter area or not?

why they are bad primers?

should I put these melting temp in pcr or what is written in a paper?

can BRCA1 gene primer be present in mRNA transcript variant for giving DNA band required in PCR?



#5 whitehorse25

whitehorse25

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 27 December 2013 - 07:32 AM

Dear doctor,

I want to check a primer sequence in human promoter area of two genes:

*BRCA1 gene:

forward:

5' TTGGGAGGGGGCTCGGGCAT 3'

Reverse:

5' CAGAGCTGGCAGCGGACGGT 3'

 

*17-Beta Hydroxysteroid dehydrogenase type 1:

Forward:

5'AGACCATCCTCACCAACAGG 3'

Reverse:

5'CCTGGCCCTGTCATTTTTAG 3'

 

I tried to find them in blast and ensembl, but :

in blast I found but I donot know their position in promoter or not

in ensemble:

I found the forward only( BRCA-1 in area not exon may promoter???) and (  2nd gene in exon)

please tell me " Is that primers right or not 

If that primer is wrong, so what is the solution?

these primer position in promoter area of that gene or not?

thanks alot 



#6 memari

memari

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 148 posts
11
Good

Posted 27 December 2013 - 08:45 AM

I told you. I made a mastake.

 

they are good.

Marker1 and 2  are in promotor of BRCA1.

 

 

http://i42.tinypic.com/mt40na.jpg


-----
Babak Memari

#7 jerryshelly1

jerryshelly1

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 328 posts
33
Excellent

Posted 27 December 2013 - 09:12 AM

Only post your topic once in its respective section. Each topic will get a considerable amount of view's when users check "view new content." 



#8 jerryshelly1

jerryshelly1

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 328 posts
33
Excellent

Posted 27 December 2013 - 09:17 AM

I usually use the BLAT tool at UCSC Genome Browser, but it appears to be offline at this time.



#9 Ameya P

Ameya P

    Rervm Cognoscere Cavsas

  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 333 posts
25
Excellent

Posted 27 December 2013 - 11:50 PM

Hi WhiteHorse, 

 

I checked your primer sequences in UCSC's In silico PCR and the BRCA primers seem to be located after the gene. While the HSD17B primers are upstream of the gene, it is difficult to say that the region is the promoter region. You would have to look up some literature or do some experiments to prove that the region you are targeting is indeed the promoter. 

 

You can also see this for yourself, if you use this link.

 

Ameya


NEW!!!!  Wonder why this was not part of Chemistry class, ever!  on CoffeeTableScience!!!!

Image copyright: Adrian Koh SF.
Replication of this art is strictly prohibited without express permission of the artist






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.