Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

cloning


  • Please log in to reply
7 replies to this topic

#1 amita22

amita22

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 14 November 2013 - 08:57 AM

Hi,

 

I have a plasmid with my gene of interest. I need to clone the gene of interest into another plasmid BUT the second plasmid does not have the restriction sites used to clone my gene into first plasmid. I have cloned my gene into the first plasmid using xbaI-NotI but in the second plasmid, the MCS does not have NotI site and therefore I need to insert sites for either salI or pstI (at 3'end). please guide me how to do this (please ignore..I am not a molecular biologist but rather have to do this).

 

Thanks in advance



#2 jerryshelly1

jerryshelly1

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 328 posts
33
Excellent

Posted 14 November 2013 - 09:08 AM

Hey Amita22

 

First you will need to determine if either SalI or PstI cut your gene of interest (GOI). I suggest using NEB cutter (freeware on NEB website > tools). If neither cut your GOI, you can use the enzyme that is compatible with XbaI. On the NEB website under tools, you will be a web app called double digest finder. You can use this pull down menu to see which enzymes are compatible for simultaneous digest. It appears as though SalI and PstI have similar compatibilities with XbaI (about 75% efficiency).

 

After digest you should purify your fragments for ligation into your new vector.



#3 amita22

amita22

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 14 November 2013 - 09:20 AM

Hi,

Thanks for the answer. No, neither salI not PstI cut my GoI. But how do I digest....my vector (with GOI) doesn't have restriction site for SalI/PstI.



#4 jerryshelly1

jerryshelly1

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 328 posts
33
Excellent

Posted 14 November 2013 - 09:30 AM

You can't digest with an enzyme if the restriction site is not there. What you will have to do is design primers that can put a 3' SalI or PstI site on your GOI. You will not be able to simply cut out your GOI.

 

Design two primers...

 

Forward Primer:

3bp random nucleotides - XbaI - 5' GOI (10-20 nucleotides)

 

Reverse Primer:

3bp random nucleotides - SalI/PstI - 3' GOI (10-20 nucleotides)

 

You can easily PCR your GOI, cut with the two restriction enzymes, purify and stick it into your new vector.

 

Good luck!



#5 amita22

amita22

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 14 November 2013 - 09:57 AM

thanks again...can I ask more?? will you be able to design both 5' and 3' primers for me. The sequences are pasted below;

 

5'  - ATGAAAAAGACAGCTATCGCGATCGCAG

3'  - TAAAACCCATACCTGTGCAGCATAGTGA

 

also, have noticed a XbaI site that cuts before RBS so have to rule out XbaI as well. Have thoroughly checked and found  BamHI (5') and SphI/PstI to be the best. Have checked the compatibility using NEB's double digest tool as well.

 

Have one more query....I am using ATG as the start codon, is that good for expression in E.Coli also or do I need to have AUG as the start codon for E.Coli.

 

many thanks in advance for all the help.



#6 jerryshelly1

jerryshelly1

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 328 posts
33
Excellent

Posted 14 November 2013 - 10:19 AM

You try designing the primers and I will tell you if I have any suggestions.

 

A general guide:

http://www.thermosci...imer-design.pdf



#7 amita22

amita22

    member

  • Active Members
  • Pip
  • 7 posts
0
Neutral

Posted 14 November 2013 - 11:19 AM

Hi have designed primers for BamHI (5'), please check which one would be good.

5' - TATggatccGCCATGAAAAAGACAGCTATCGCG

5' - ATAggatccGCCATGAAAAAGACAGCTATCGCG

5' - CGCGTggatccGCCATGAAAAAGACAGCTATCGCG

5' - CGCggatccGCCATGAAAAAGACAGCTATCGCG



#8 jerryshelly1

jerryshelly1

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 328 posts
33
Excellent

Posted 14 November 2013 - 12:14 PM

Hey,

 

I forgot to mention that adding 3bp is only done to the 5' or 3' end of your restriction site because some enzymes require larger overhangs for efficient cutting. You can access the cleavage efficiency close to DNA ends on the NEB website (https://www.neb.com/...f-dna-fragments).

 

Your primers look good, but I would change a couple of things...

 

The underline portions are not necessary. The overhang is required on the 5' end to ensure efficient cleavage.

5' - TATggatccGCCATGAAAAAGACAGCTATCGCG

5' - ATAggatccGCCATGAAAAAGACAGCTATCGCG

5' - CGCGTggatccGCCATGAAAAAGACAGCTATCGCG

5' - CGCggatccGCCATGAAAAAGACAGCTATCGCG

 

I would use...

 

Forward primer with BamHI (3bp overhang):

 

5' - ATAGGATCCATGAAAAAGACAGCTATCGCG - 3'

 

IDT Oligo Analyzer

 

ENGTH: 29 GC CONTENT: 44.8 % MELT TEMP: 60.0 ºC MOLECULAR 
WEIGHT:
8943.9 g/mole EXTINCTION 
COEFFICIENT:
295400 L/(mole·cm) nmole/OD260: 3.39 µg/OD260: 30.28

 

Reverse primer with PstI (2bp overhang):

 

5'-ATCTGCAGTCACTATGCTGCACAG-3'  

 

LENGTH: 24 GC CONTENT: 50.0 % MELT TEMP: 59.2 ºC MOLECULAR 
WEIGHT:
7312.8 g/mole EXTINCTION 
COEFFICIENT:
227000 L/(mole·cm) nmole/OD260: 4.41 µg/OD260: 32.21

 

 

 

*You should double check and make sure if your plasmid will epitope tag your GOI. If it does, you need to consider if it will be at the 5' or 3' end of your gene.






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.