Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

sequences in 1001genomes


  • Please log in to reply
3 replies to this topic

#1 frechdachs

frechdachs

    member

  • Members
  • Pip
  • 2 posts
2
Neutral

Posted 25 October 2013 - 12:01 AM

I am new here and sorry if my question is very stupid but I dont know how to deal with the sequence data from http://www.1001genomes.org/

 

Normally we have a sequence like this

AAAATTCAGGAACACAAAAAGACTAATCTTTTTGCTAAGAACAAGAAGAAATTAGCTTCT
CTCAATGTGATTTGATATTGAGAGTCAATTATGGTAGTGATGAAACAAATACCCGTAAAC
TCTTCGTCACTCTCTCTCTCTATACGAAGTGGTCGGAGAAGTTCAACGGAGAAGACGACA
GCAGAAAACCACGACAAAGATTGTGGGACGAAAACGCAAGAACGACGACGTTTCAGCTAG

 

And from http://www.1001genomes.org/ they look strange' with some columns if I open them in excel ( I dont know how to attacht a picture here :-((

 

What should I do to get the sequence in only ATCG order?

 

I want to look for sequences from some accessions.

 

Thank you very much rolleyes.gif

 

 



#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,664 posts
394
Excellent

Posted 25 October 2013 - 12:09 AM

Sounds like you need what is known as a FASTA file (max line length 60 characters, no spaces usually). No idea if 1000 genomes provides them.

#3 frechdachs

frechdachs

    member

  • Members
  • Pip
  • 2 posts
2
Neutral

Posted 25 October 2013 - 01:59 AM

yes, thats what I need but they dont provide :-(


Edited by frechdachs, 25 October 2013 - 01:59 AM.


#4 El Crazy Xabi

El Crazy Xabi

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 197 posts
20
Excellent

Posted 27 October 2013 - 03:27 PM

Just paste it as new sequence in BioEdit and save as fasta






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.