Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Ligation of PCR fragments

cloning ligation PCR smearing transformation

  • Please log in to reply
11 replies to this topic

#1 thefallengrace

thefallengrace

    member

  • Active Members
  • Pip
  • 15 posts
2
Neutral

Posted 21 September 2013 - 11:19 PM

Hi there, i need experts help for my experiment.

 

I need to ligate 3 pcr fragments, and clone them into a vector.

 

So i have fragment A, 500bp, fragment B, 800bp and fragment C, 489 bp

 

i need them to be in this arrangement

 

A---B---C

 

PCR of all the fragments have no problems at all.

 

Next, i start with the ligation of A to B

 

SacI---A---EcoR1

EcoR1---B---Spe1

 

I column purified them after PCR, and digest them in EcoR1, overnight.

Column purified them again, and ligate them overnight.

i diluted them 100X, and run PCR with Forward primer of A and Reverse primer of B

 

And i get a nice band at 1300bp.

 

Next, i column purified AB, digest AB and C with Spe1 overnight, column purified and finally ligate them. Same as what i did for AB.

 

Here where the problems come....

 

all i get is smearing, a bright smearing originated from the well.

 

But i did see a band near to 2000bp (my expected band)

 

So i proceed with gel extraction, cloning and transformation, but didnt get any colony at all (did it 3 times)

 

My boss said that i cannot gel extraction it , because the band is too smearing.

 

He asked me to ligate again, and run the ligation mixture in gel, and visualize them.

 

But all i can see is smearing, can someone tell me what happen here? i thought i should see bands.

 

Anyway, i start again my ligation, using new ligase, new ddH2O, new diluted primers, did a new pcr of ABC, and the smearing is gone but the band which i had seen at 2Kb is now disappear along with the smears. All i got is a bands at 500bp, 800bp and some bands under 1000bp.

 

What happen here?

 

My hypothesis is, i have a contamination is one of my ligation ingredients, and it seems that my digestion of AB and C is not complete. The bands i saw is just ligation of C with C...

 

I start a new digestion of AB and C and will ligate them and pcr them tomorrow, 

 

 

 

can someone help me?



#2 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,271 posts
213
Excellent

Posted 22 September 2013 - 05:45 AM

Do you have 5' overhangs past the SpeI site on your primers?



#3 thefallengrace

thefallengrace

    member

  • Active Members
  • Pip
  • 15 posts
2
Neutral

Posted 22 September 2013 - 08:36 PM

I have..

 

For fragment B

AAAAAAAACTAGTCCCCGAAAAGTGCCACCT

 

 

For fragment C

TTTTTTACTAGTGGTTCCAGGGTCAGCTCG

 

 

So it will look like this,

 

A---B--TGATCAAAAAAAA----TTTTTTACTAGT---C


Edited by thefallengrace, 22 September 2013 - 08:42 PM.


#4 julianak77

julianak77

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 24 September 2013 - 06:40 AM

Did you check how your SpeI work? May be overnight is too long for SpeI, 

Try to cut with SpeI for 2-3 hours and than ligate the same amounts of the fragments. 



#5 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,271 posts
213
Excellent

Posted 24 September 2013 - 06:58 AM

The primers look fine, but your last diagram is very wrong. The primer attached to B is (should be) the reverse complement, not the reverse. This is probably not your problem, but you should certainly understand why this is true. The figure should be:

 

A---B--ACTAGTTTTTTTTT----TTTTTTACTAGT---C

 

After ligation, do you amplify your ligation product with forward primers to A and reverse primers to C?

Is there a product?



#6 thefallengrace

thefallengrace

    member

  • Active Members
  • Pip
  • 15 posts
2
Neutral

Posted 25 September 2013 - 04:52 AM

Hi there,

 

thank u for ur replies. 

 

@julianak77

i know my speI work because i tested it with my vector, plus that RE just arrived the day before.

 

@phage434  

sorry for the wrong diagram, had a long day when i did that diagram :)

Yes, i did amplify my ligation product using Forward A and Reverse C.

There is a band at the right size, but it comes with a thick smearing.

I manage to get the smearing disappear, as it turns out there is contamination in either my ligase,buffer,DNTP or ddH2O, unfortunately the band also disappear                           with the smearing. 

 

Now things are getting even weirder, i tried to amplify again my A---B, bu i cannot, it seems the product is degrading. 

Maybe there is Dnase in my sample??

So now i need to restart whole over again, will try to amplify A, B and C tomorrow.....



#7 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,271 posts
213
Excellent

Posted 25 September 2013 - 07:37 AM

I think you are doing too many purifications. I would purify the PCR products, (run a gel to check they are there and the right length) then mix them and cut with both EcoRI and SpeI simiultaneously. Heat kill  both enzymes, then ligate. PCR with the outermost primers.

 

With either strategy, you have to expect many side products. A can bind to A or B. B can bind to B or C. So you could end up with products like this:

 

A-B-C

A-B-B-A

A-A

B-B

A-B-C-C-B



#8 thefallengrace

thefallengrace

    member

  • Active Members
  • Pip
  • 15 posts
2
Neutral

Posted 26 September 2013 - 02:04 AM

Yeah, i think i purified too much, losing a lot of products in the process.

May i know whether heat inactivation is sufficient enough?

And after i heat kill them, can i just put ligase directly to the tube? or i need to add ligase buffer? 

How bout the salts and short nucleotide, which has been cut by the Res.


Edited by thefallengrace, 26 September 2013 - 02:07 AM.


#9 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,271 posts
213
Excellent

Posted 26 September 2013 - 12:15 PM

Heat killing enzymes works very well, leaving the DNA in your RE buffer. Often this can be directly used in ligation, either by using small amounts in a T4 ligase buffer reaction, or by adding ATP to the unpurified DNA (the RE buffer is an acceptable ligation buffer, except for needing some ATP in the reaction).



#10 julianak77

julianak77

    member

  • Active Members
  • Pip
  • 5 posts
0
Neutral

Posted 27 September 2013 - 09:58 PM

When you amplify your fragments with primers A and C . How much DNA you put into the reaction? 



#11 thefallengrace

thefallengrace

    member

  • Active Members
  • Pip
  • 15 posts
2
Neutral

Posted 28 September 2013 - 02:16 AM

i didnt know exactly how much dna i put, but i used 1uL, when i get smearing, i diluted the template 100x,1000x,10kx and 100kx time, but still smearing.



#12 OA17

OA17

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 83 posts
3
Neutral

Posted 23 October 2013 - 12:40 PM

Hi!

I don't know if you have already solved your problem, but for my it also seems that you are making too many purifications, ligations and so on.

 

When I have had to fuse 3 fragments A, B and C, I usually amplify the three of them separately by PCR, clean the PCR with a column if I get a single band (if not, I do a gel-purification by freeze and squeeze).

Then I fuse A+B in a recombinant PCR and B+C in another recombinant PCR. 

Finally, either I join A+B with B+C using a restriction site if it is available in B, or I make a third recombinant PCR in which the templates would be both A+B and B+C and the final product should be A+B+C. In the first case I would directly clone A+B and B+C into the vector by making a triple ligation. In the second case, I would clean the PCR and I would proceed with the cloning.

 

For me it's much easier and I have done it many times (with success!). Most probably, you will only need to design long primers containing tails for the overlapping ;)

 

Hope it helps and hope it works!







Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.