Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

transcript variant X

transcript variant X

  • Please log in to reply
5 replies to this topic

#1 chaghaleh

chaghaleh

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 19 September 2013 - 07:04 AM

Hello

Do you know what is the meaning of transcript variant X?

Some genes have transcript variant X.


Edited by chaghaleh, 19 September 2013 - 07:04 AM.


#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,831 posts
415
Excellent

Posted 19 September 2013 - 03:36 PM

In what context?  Usually X implies an unknown in mathematics, but I suspect in this case they are referring to a known variant that they have called "X" in the paper you are reading.



#3 chaghaleh

chaghaleh

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 20 September 2013 - 03:56 PM

I have seen it a lot during Primer Designing:

Lets check a pair of primers for ACTB:

Goto

http://www.ncbi.nlm....s/primer-blast/

Copy and Past these primers there:

CACCATTGGCAATGAGCGGTTC

AGGTCTTTGCGGATGTCCACGT

Then click on "Get Primer". Now you see this link:

 

http://www.ncbi.nlm....9004_primertool

 

Which has these links below:

 

http://www.ncbi.nlm....de&id=530384922

http://www.ncbi.nlm....de&id=530384920

http://www.ncbi.nlm....de&id=530384918

http://www.ncbi.nlm....de&id=316659408



#4 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,831 posts
415
Excellent

Posted 20 September 2013 - 07:45 PM

http://www.ncbi.nlm....ference_betwe_1



#5 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 22 September 2013 - 10:40 AM

There is really little information about the nomenclature of "transcript variant Xn" on NCBI site. I guess they represent variants of all model mRNA (predicted mRNAs) refseqs. In the example of ACTB, there are 3 model RefSeqs (XM_005249819.1XM_005249820.1, and XM_005249818.1), corresponding to transcript variant X1, X2 and X3. So from this example, it is clear to me that "transcription x" is one of the model RefSeqs for a particular gene. 

 

The link given by Bob above tells the differences between model refseq (XM_xxxxxxxx) and experimentally derived refseq (NM_xxxxxxx).



#6 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,831 posts
415
Excellent

Posted 22 September 2013 - 11:59 PM

pcrman: I thought that was the difference between the X variants and other sequences - they were predicted rather than experimental - could easily be wrong though, don't need to use the NCBI database to that extent very often, so still learning myself.






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.