Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

***In Silico PCR producing output for incorrect sequence***


Best Answer dpo, 28 August 2013 - 06:40 AM

When I try them out, they amplify exactly what they should ... However, there is a mismatch between the forward primer and the template at the 3' end (the penultimate base), so I doubt whether these are ideal to amplify the wild type allele.

 

This is the sequence of the resulting amplicon (I removed the last two bases from the forward primer):

>uc003vwx.1__TAS2R38:185+404 220bp CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGC AGGTTGGCTTGGTTTGCAATCATC
CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCaggcactg
agcaacagtgattgtgtgctgctgtgtctcagcatcagccggcttttcct
gcatggactgctgttcctgagtgctatccagcttacccacttccagaagt
tgagtgaaccactgaaccacagctaccaagccatcatcatgctatgGATG
ATTGCAAACCAAGCCAACC
Go to the full post


  • Please log in to reply
2 replies to this topic

#1 centralamgod

centralamgod

    member

  • Active Members
  • Pip
  • 10 posts
2
Neutral

Posted 28 August 2013 - 06:05 AM

I need your assistance:

 

I am using UCSC's In Silico PCR to test primers that have been designed by a previous student.  I should amplify a partial region on chromosome 7 (gene TAS2R38)

 

The designs are: 

 

F:  5’- CCT TCG TTT TCT TGG TGA ATT TTT GGG ATG TAG TGA AGA GGC GG -3’

R:  5’- AGG TTG GCT TGG TTT GCA ATC ATC -3’

 

However, when I plug them in, the output suggests that it amplifies a region on chromosome 22.  Can anyone explain why I'm getting these results?

 

Thank you kindly.



#2 dpo

dpo

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 89 posts
5
Neutral

Posted 28 August 2013 - 06:40 AM   Best Answer

When I try them out, they amplify exactly what they should ... However, there is a mismatch between the forward primer and the template at the 3' end (the penultimate base), so I doubt whether these are ideal to amplify the wild type allele.

 

This is the sequence of the resulting amplicon (I removed the last two bases from the forward primer):

>uc003vwx.1__TAS2R38:185+404 220bp CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGC AGGTTGGCTTGGTTTGCAATCATC
CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCaggcactg
agcaacagtgattgtgtgctgctgtgtctcagcatcagccggcttttcct
gcatggactgctgttcctgagtgctatccagcttacccacttccagaagt
tgagtgaaccactgaaccacagctaccaagccatcatcatgctatgGATG
ATTGCAAACCAAGCCAACC


#3 centralamgod

centralamgod

    member

  • Active Members
  • Pip
  • 10 posts
2
Neutral

Posted 28 August 2013 - 07:29 AM

Thank you dpo!






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.