Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo

scrambeled miR sequence


  • Please log in to reply
5 replies to this topic

#1 mahrak

mahrak

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 40 posts
3
Neutral

Posted 25 August 2013 - 05:28 AM

hello every body

 

1- I have got this sequence and I want to verify if it is a good scrambeled miR. what should I do?

2- are there databases to search for microrna targets based on sequence NOT miRID?

 

 

tnx

 



#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 25 August 2013 - 11:32 AM

you can do a blast search using the scrambled sequence and choose RefSeq as database and "Optimize for Somewhat similar sequences (blastn)" as program.



#3 mahrak

mahrak

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 40 posts
3
Neutral

Posted 25 August 2013 - 10:25 PM

tnx PCRman. I was wondering if you coudl take look at the results. I used https://www.genscrip...in/app/scramble to scramble my miR. are there other sources to get the job done?

 

all the best



#4 mahrak

mahrak

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 40 posts
3
Neutral

Posted 25 August 2013 - 10:26 PM

sry here are the results: file:///C:/Users/mahsa/Desktop/scrambeled%20miR.htm



#5 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 26 August 2013 - 08:36 AM

you did not upload your results. the site doesn't allow you to upload html file, you can just post the sequence of the scrambled miRNA here. 



#6 mahrak

mahrak

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 40 posts
3
Neutral

Posted 26 August 2013 - 09:21 PM

oops. sry for that. here are my two candidates for scrambled microrna:

1- GAATAACTAGATCGTCCTAAT

2- GATCGAACCTAGACTAGTGGT

 

dose Ambion provide online services for scrambled microrna design? are there other sites of sort i could consult?

 

all the best






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.