Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

PCR of GC-rich sequence (E-cadherin)


  • Please log in to reply
6 replies to this topic

#1 criscastells

criscastells

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 58 posts
1
Neutral

Posted 11 July 2013 - 12:27 AM

I am working with the promoter of E-cadherin during the last months analyzing the effect of different matix on methylation patterns. I am trying to optimize the PCR amplification conditions and I have noticed that I can only amplify non-methylated sequences (I work with controls: completely methylated and unmethylatde from Qiagen). I have been trying to change different parameters of the PCR:
- Protocol from normal one to slowdown PCR
- Mg concentration from 1,5 to 3 mM
- Polymerase without hot start or without
- Use of PCRx Enhancer solution from life tech (using this buffer it was possible to start amplifying samples without methylation)
- Amplify long (321bp) and short (172bp) sequences.
- Primer quantity from 0.2mM to 1.2mM

Right now I have no more ideas and I would like to ask you for some advice. Does someone work with this promoter and can give me some new directions?

Thanks you very much in advance

#2 lmg

lmg

    member

  • Active Members
  • Pip
  • 20 posts
1
Neutral

Posted 11 July 2013 - 01:11 AM

Hello,

were you primers designed to amplify both methylated and un-methylated seq?

#3 criscastells

criscastells

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 58 posts
1
Neutral

Posted 11 July 2013 - 06:47 AM

Yes I designed primers within the zone without CpG islands with the aim that the same primers can amplificate both sequences.

#4 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 11 July 2013 - 07:15 AM

when you bisulfite convert the sequence, it is no longer GC rich, instead GC depleted.

So, you are doing bisulfite sequencing PCR, right? How do your PCR cycling conditions look like? Can you post your primer sequences? Is the unmethylated DNA from Qiagen also bisulfite modified?

#5 criscastells

criscastells

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 58 posts
1
Neutral

Posted 11 July 2013 - 08:06 AM

Well I have no problems with the demethylated sequence which is not longer CG rich, but I have problems with the methylated one that mantains the CG sites (I know that the other C are converted to U and then T when amplified)

So, yes, I am doing bisulfite sequencing PCR.
1. I have tried different PCR protocols. Firstly a normal PCR about 50 cycles with 30 sec of denaturing, annealing and extension. Then I have tried to develop two different PCR protocols from these articles: Russell P. Darst et al 2010 and Ulrich H Frey et al 2008. The first one increase the times of denaturing,annealing and extension during the cycles and the second one defines a slowdown PCR.
2. The primers I mostly uses (the ones that have amplified the unmethylated sequence): f GTA ATT TTA GGT TAG AGG GTT AT, r CTCCAAAAACCCATAACTAAC
3. The control samples (methylated and unmethylated) are both bisulfite treated.

#6 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 11 July 2013 - 08:30 AM

Since you can amplify unmethylated DNA, your primers are doing fine and you may need to tweak your annealing temperature. In addition, if you run 50 cycle, you may need to supplement Taq during the run. I prefer two rounds of PCR: 40 cycle of first run, 25-30 cycle of 2nd run.

#7 criscastells

criscastells

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 58 posts
1
Neutral

Posted 15 July 2013 - 07:29 AM

Thanks you very much for your advice. I will continue working on it!!




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.