Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

How do I know the orientation of my insert in a plasmid after sequencing?

orientation insert plasmid sequencing rna probe

  • Please log in to reply
2 replies to this topic

#1 bioguy

bioguy

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 18 April 2013 - 09:21 AM

Hi,

I just received the results of the sequencing of several plasmids I received from other lab. I ran a PCR with M13F and M13R and sequenced them with M13F or M13R. Now I need to know the orientation of the insert and which enzymes I need to use to make RNA probes. How can I get this information? Below is one of my sequences. Thank you very much.

>PCR-M13R (supposed to be Danio rerio collagen, type I, alpha 2)
GMYGCATACCCTCACTAAAGGGAACAAAAGCTGGAGCTCGCGCGCCTGCAGGTCGACACTAGTGGATCCAAAGAATTCGG
CACGAGGCAAGAACTGGTACAGAAGCTCCCAGGAGAAGAAACACACCTGGTTTGGCGAGACTATCAACAGTGGTACTGAG
TTTGCTTACAATGACGAGACCCTGAGCCCACAATCCATGGCTACTCAGCTGGCCTTCATGCGTCTACTGGCCAACCAGGC
AGTCCAGAACATCACCTACCACTGCAAGAACAGCATCGCCTACATGGATGCTGAGAATGGAAACCTGAAGAAGGCTGTGT
TGCTGCAGGGTTCCAATGATGTTGAGCTCAGGGCGGAGGGCAACAGCCGCTTCACTTTCAGCGTCCTAGAGGATGGCTGC
AGTAGACACACTGGCCAGTGGAGCAAGACAGTCATTGAATACAGAACAAATAAACCATCTCGCCTTCCCATCCTCGACAT
TGCACCTTTGGACATTGGTGGCGCAGATCAAGAGTTTGGTTTGGACATTGGCCCAGTCTGTTTCAAATAAATAGACTCAT
GATAAATTAAACGAGAGAAAGAAAGAAAAAAGAAAAATCTCTGCCCTTCTTTCTGTGTTTTTTTATACTGAATGCTGATT
TTTTTCCGCAAATCCACTTGCTTAAGCTGGGCTCTATCGGAGTGGACCAATGGACTGAACGGAGCATTGCGCAATGCAAA
TTAATACAGCAGCCCAAAGAGACGCGGGAGGGATAACACCATGTTATGGGACATGTCATCATTTTGTAAAAATTAAAGAA
GTGTAATAAAAAGAATGAAAGTATACATCACTTTGTGGTCTTTGTATATCTTCCAAAGAGGAAGTTTAAAACCACAATTT
CCGTAAGGTTTAAACTACCTCATGTGTAAAGGAAAATAATAATCAACATCCTAGTCGTCGCTAGATGGTACTAACGCTTC
AAGTTCTGTCCTGTTTCAAAGTGCTCCAATACTTGAAGCAGTGATATTATATGGTGCTAAACATGCAGCTGTGGAGAAAA
CCACTGTACTGTATACTTTGTATGTCTCTACGATATGGCACAGTCCCCTGATATCCATTTTAGCAGTGATATCCTAACTG
AAKGTATGTYCKGGCTTTGACCTTTGGCT


#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,160 posts
65
Excellent

Posted 18 April 2013 - 10:32 AM

If you have already sequenced your plasmid using M13F and R primers, the resulted sequence should tell the orientation of the insert because you know the location of the primers in the vector and which primer gives you which sequence.

#3 bioguy

bioguy

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 18 April 2013 - 11:42 PM

Yeah, but some I sequenced with M13F and some with M13R, so now what EXACTLY should I do to check the orientation? Should I blast the sequences and see if the alignment with the blast hits returns a plus/plus strand? Then, does that mean that I have the sense sequence? What about the polymerase? I found SP6 in some of my sequences, but it was the reverse complement of SP6. What does that mean?





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.