Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Discontinuous/non-sequential sequences


  • Please log in to reply
1 reply to this topic

#1 TJCooper

TJCooper

    member

  • Active Members
  • Pip
  • 6 posts
0
Neutral

Posted 12 April 2013 - 11:00 AM

Good evening!

I am searching for a way to analyse sequence-reads that contain blocks of sequence from 2 (or more) different genomic regions i.e.:

GATCGATGACTGTACGTGACAGCTAGTAAATAGTACCC
Genomic Region 1
Genomic Region 2

Any amount of the genome could theoretically reside between the two regions that were ligated to create this fragment.

Does anybody know of any software/program which will identify from where in the genome each block originated or have any suggestions on how I could accomplish this?

Many thanks for any help!

- TJC

#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,657 posts
392
Excellent

Posted 12 April 2013 - 02:24 PM

If it is one of the commonly studied organisms you could try UCSC's BLAT tool. BLAST might work, but would probably need more sequence than you have provided.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.