20 replies to this topic

[zzha158]

I am trying to design point mutation of a protein. After sequencing, the product I have got is not mutated. Could someone help me ,what may go wrong?

Cheers

AGGAGGATGAAGATGTCTCCAAGGAATATG, the highlight codon is the AA I want to change to Ala, and I designed a forward primer based on  this part and replaced T to G, and corresponding reverse primer.




Joe

[GNANA]

you got to give us more detailed information about how you did ( PCR condition, Dpn digestion, about your competent cells,??? etc,) then its easy to help you troubleshoot.

[zzha158]

GNANA, on 28 February 2013 - 02:15 PM, said:

you got to give us more detailed information about how you did ( PCR condition, Dpn digestion, about your competent cells,??? etc,) then its easy to help you troubleshoot.

Hi GNANA,

Thank you for replying. The cDNA is human histidine-rich Ca2+ binding protein cDNA, the vector is pCMV6-NEO.

Firstly, I designed the forward and reverse primers replacing T to G, which GCC is a codon of Ala. In addition, we also used T7  froward primer and an revers primer overlapping XhoI restriction digest site. We set up two PCR reactions. The first reaction has T7 primer, and HRC mutation reverse primer, HRC cDNA plasmid, . The other reaction has HRC mutation forward primer and Xhol reverse primer.
PCR conditions: 94ºC 3 min, 98ºC 10s , 60ºC 15 s, 72ºC 40', 30 cycles. After PCR, we have two DNA segments, the lengths of them are the ones we expected after running DNA gel and purification of These two DNA segments.

Next, we set up another PCR reaction. The templates are the two DNA segments from the first PCR, the primers are T7 forward and Xhol reverse. This will generate a long DNA as we expected. We then cut the HRC cDNA plasmid and this long DNA segments with EcoR1 and Xhol restriction enzyme 90 min 37ºC (at the last 30 min, treated with CIAP 1ul in 20ul). The restriction digest worked.

Then we used overnight ligation method (16ºC) T4 ligase 1 ul, 10* buffer 1ul, the ratio of  insert/ vector  is set at variations with minimum of 3:1.

The ligation mix was then used for transformation of Dh5alpah competent cells. 65ul cell solution and 1.5 ul ligation mix incubated on ice for 30 min, then heatshock 42ºC for 45s then on ice for 2min then added 1ml 2*YT let it grow on shaker for 1h 37 ºC, before spread.

After spread and grow overnight, we can see a few colonies (~ 30) depends on the ratio of insert/vector. Then we picked the colonies did mini prep, then sequencing. The report showed that the site we want to mutate was still TCC. So I dont know where it goes wrong using this method.

[GNANA]

It sounds like your aim is to incorporate a mutation and then subclone it in another  vector simultaneously.  if this is the case, your result looks like your digestion and ligation procedure does no harm, but the problem looks like the mutation incorporation...so after the firstphase of PCR did you gel purify both products?? if not, the parent template carry over to the second PCR would dominate and so the resulting second round PCR product would be from the parent template itself...

[Trof]

Can you restrict the wild-type sequence with some enzyme that doesn't cut mutant? So you will get rid of the wild-type fragmets, in theory.

By the way, is there a reason why you didn't used the classic DpnI mediated site-directed mutagenesis, either with kit or without? This method efficiently removes original plasmid and has a good success rate.

[zzha158]

GNANA, on 04 March 2013 - 02:00 AM, said:

It sounds like your aim is to incorporate a mutation and then subclone it in another  vector simultaneously.  if this is the case, your result looks like your digestion and ligation procedure does no harm, but the problem looks like the mutation incorporation...so after the firstphase of PCR did you gel purify both products?? if not, the parent template carry over to the second PCR would dominate and so the resulting second round PCR product would be from the parent template itself...

Thanks for your reply. I did run a gel and extracted the DNA we expected. Thats why I dont understand the mutation is not incorporated .

[zzha158]

Trof, on 04 March 2013 - 09:57 AM, said:

Can you restrict the wild-type sequence with some enzyme that doesn't cut mutant? So you will get rid of the wild-type fragmets, in theory.

By the way, is there a reason why you didn't used the classic DpnI mediated site-directed mutagenesis, either with kit or without? This method efficiently removes original plasmid and has a good success rate.

Thanks for ur reply and suggestion. If my method is still not working (sent more for sequencing), we probably will try DPNI method. The reason why we dont use the quick change way is that since our plasmid is about 7kb, due to the PCR error, we dont want to introduce any errors to the mutated DNA. If my way does not work, we will do DPNI way.

According to my supervisor, since he used that method to generate mutation of protein which is ~550kDa, my smaller protein DNA should work. But science is science, it does not always work as u expect.

[Trof]

I see. I had personally concerns about the PCR errors too, but now there are polymerases with very low error rates available.
Also you can do a quickchange mutagenesis in one plasmid, and then cut off just a small portion of the gene containing mutation (which you can completely verify by sequencing) and ligate into a a fresh vector of same kind. I did it like this.

Sometimes the primers itself may be problematic in mutagenesis, in both DpnI mediated and other methods, sometimes it works fine, different mutation is hard to achieve.

[zzha158]

Trof, on 05 March 2013 - 02:17 AM, said:

I see. I had personally concerns about the PCR errors too, but now there are polymerases with very low error rates available.
Also you can do a quickchange mutagenesis in one plasmid, and then cut off just a small portion of the gene containing mutation (which you can completely verify by sequencing) and ligate into a a fresh vector of same kind. I did it like this.

Sometimes the primers itself may be problematic in mutagenesis, in both DpnI mediated and other methods, sometimes it works fine, different mutation is hard to achieve.

Hi,
I have new problem now. I have tried DPNI method twice, there was no colony. Can someone  give me some idea why that happened and how I improved it

Thanks

[GNANA]

Are you sure the PCR worked ? what about the efficiency of the competent cells you using ?

[zzha158]

GNANA, on 10 March 2013 - 11:34 PM, said:

Are you sure the PCR worked ? what about the efficiency of the competent cells you using ?

I dont use the quick change lit. How do I test it ?

[GNANA]

you dnt necessarily need to use the kit, can very well do site directed mutagenesis using a High fidelity pol/mix and the Dpn, + good competent cells obviously...is your question is about, how to test the efficiency of competent cells? if so you will find enough info in this link..http://www.protocol-..._transformation

[zzha158]

GNANA, on 14 March 2013 - 09:05 AM, said:

you dnt necessarily need to use the kit, can very well do site directed mutagenesis using a High fidelity pol/mix and the Dpn, + good competent cells obviously...is your question is about, how to test the efficiency of competent cells? if so you will find enough info in this link..http://www.protocol-..._transformation

Thank you for your help. I did a positive control last week. It seemed that the amount of DNA was low (our home-made cells are not that competent), I increased the DNA up to ~400 ng, and the transformation succeeded. Now I am just waiting for the sequencing report. If the sequencing reports no mutation as I wanted, what should I do next. Keep on trying or change the protocol.

I really appreciate your help. At the moment, my supervisor is admitted in hospital and this is my first time to use this technique.

[zzha158]

Sequencing shows no mutation at that site, it is really frustrating. I have been doing this for months. Is it due to primer?

[GNANA]

i dnt think it is because of ur primers, getting transformants in 400ng  says ur cells are not efficient enough....i would suggest you to redo the cells and proceed only when you get good number of transfomants at 10pg conc of plasmid.