Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

Primer designing for Methylation

primer

  • Please log in to reply
6 replies to this topic

#1 jerumm

jerumm

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 26 February 2013 - 10:26 PM

I want to identify a set of primer sequences which has been used for many years within the promoter region of that gene.

The primer in question is standard MGMT promoter region primers for methylated and unmethylated regions:

1


MGMT (MSP) unmeth F
TTTGTGTTTTGATGTTTGTAGGTTTTT

2


MGMT (MSP) unmeth R
AACTCCACACTCTTCCAAAAACAAAACA

3


MGMT (MSP) meth F
TTTCGACGTTCGTAGGTTTTCGC

4


MGMT (MSP) meth R
GCACTCTTCCGAAAACGAAACG

I am unable to find these sequences within the gene promoter region, the genbank id of which is X61657.

It be very helpful if someone could help me out with it.

Thanking you
Jeru
Ph.D Scholar,
Dept. of Human Genetics,
NIMHANS

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 26 February 2013 - 10:54 PM

Hi Jeru,

I don't know if you are aware that bisulfite PCR primers are designed on bisulfite modified DNA. It is not very easy to find the exact location of a MSP primer on DNA without modifying the DNA. For M primer, you need to first convert all non-cpg C's to T, and then search the primer in the sequence. For U primer, convert all Cs to T, and then search for the primer sequence.

You can use a text editor or Word to modify the sequence. If you only change non-cpg C to T, you can first change "CG" instance to "DG", then change all C to T, then change DG back to CG.

#3 lmg

lmg

    member

  • Active Members
  • Pip
  • 20 posts
1
Neutral

Posted 26 February 2013 - 10:56 PM

If you are searching for a methylated primer sequence on non-bisulphite converted DNA, you won´t find it. Try Methyl Primer Expres software.

#4 jerumm

jerumm

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 26 February 2013 - 11:24 PM

Hello Sir,

Thank you for the immediate reply.
I am aware of that, so my how do we find the exact region which is amplified in the product.
I wanted to design primers to check the methylation status of another region within the promoter sequence, the reason for this query

#5 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 26 February 2013 - 11:41 PM

The primers are usually designed on primer sequences or within CpG islands which often appear in promoters. To find promoter sequence, please take a look at this post
How to find promoter sequence for methylation study

http://www.protocol-...hylation-study/

#6 jerumm

jerumm

    member

  • Members
  • Pip
  • 3 posts
0
Neutral

Posted 04 March 2013 - 03:42 AM

Thank you Moderators and IMG, your information was very useful.

I have an other query, what are the factors which are to be considered for selecting an optimum MSP primer?

#7 rakun

rakun

    member

  • Active Members
  • Pip
  • 13 posts
0
Neutral

Posted 25 July 2013 - 04:35 AM

Thank you Moderators and IMG, your information was very useful.

I have an other query, what are the factors which are to be considered for selecting an optimum MSP primer?


Hi Jeru,

I put the link to the publication dealing with methyl-specific PCR primer design

http://www.ncbi.nlm....ubmed/12424112.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.