Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

5'end of pcr product was degraded after ligation and transformation

cloning

  • Please log in to reply
5 replies to this topic

#1 Awnman

Awnman

    member

  • Members
  • Pip
  • 2 posts
2
Neutral

Posted 18 February 2013 - 07:30 PM

Dear researchers, I'm cloning 1.6 kb DNA which encode L1 gene of Human papilloma virus type 16 into pBluescript sk +. After cutting pcr product and vector, I have checked the quality of these cutting products by gel electrophoresis and they are correct (size of bands). Then, I set ligase reaction with 2 ratios 3:1, 1:1 and transform 10ul to 100ul E.coli DH5a and spread biomass on petry disk contain LB ampicillin IPTG Xgal overnight at 37oC. There are 3 white colonies on 3:1 and 1:1 dishes ( all control dishes are ok) so I do pcr reaction with those white colonies but there is no band on gel. I cast doubt on the condition of pcr reaction so I extract plasmids from these white colonies and I see that these plasmids have bigger size in comparison with original pBluecsript. After that, I use some methods to test these plasmids:
- PCR with specific primers for the gene with these plasmids width different dilution 1:10,1:20,1:50,1:100 but there is still no band.
- Cut plasmids with NheI and HindIII ( enzymes have recognition site on forward and reverse primers) but only hindIII can cut plasmids, I have checked the activity of NheI and it is ok.
- Cut plasmid with NdeI which have recognition site on L1 gene ( in the middle of the gene and it doesn't have recognition site on pBluescript) and this enzyme can cut the plasmid.
So, after tests above, i cut plasmids with hindIII and BamHI ( I think that they cover the ligated DNA) and I see that there are a 1kb band and a 3kb band ( size of cut pBluescript). In conclusion, with all the results above, I think that my pcr product was degraded and I lose 600 kb at 5'end of the gene during ligation and transformation reaction because NheI recognition site locate on foward primer.
Idont know why this phenomenom happened. Please give me some explainations and sugesstions for my case, thank you very much !

Edited by Awnman, 18 February 2013 - 07:32 PM.


#2 neuron

neuron

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 143 posts
3
Neutral

Posted 19 February 2013 - 01:18 AM

no idea of this phenomenaPosted Image . You said you checked the sizes of your vector and insert before ligation and both were fine. Then What could happen during transformation. your interpretation may be right but DNA is quite stable then why will 5' end be degraded? I would repeat the experiment to confirm if actually it is happening. Also by checking NheI, Hind III and NdeI, you would be getting a single band, only BamHI and HindIII gives you two bands, that could be some junk DNA?

#3 jerryshelly1

jerryshelly1

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 106 posts
9
Neutral

Posted 19 February 2013 - 07:44 AM

Sounds like you may have some recombination with genomic DNA.  I would maybe try a more suitable cell line, besides DH5alpha.  DH5alpha are my go to cells as well, but sometimes they like to do funky things depending on the plasmid and insert that you are trying to transform.  

I doubt there was any degradation of your original PCR product.  How are your doing a PCR? What primers were you using (cloning primers would explain no results)?  Did you see anything on the gel (smear)?  

Let me know

#4 Awnman

Awnman

    member

  • Members
  • Pip
  • 2 posts
2
Neutral

Posted 19 February 2013 - 08:26 PM

@neuron and jerryshelly1:
I used this pairs of primer for my PCR reaction:
f-primer: 5' CATATTTTTGCTAGCATGTCTCTTTGGCTGCCT 3' (Nhe site is red)
r-primer: 5'GTACATAAAGCTTTTACAGCTTACGTTTTTTGCGTTT3' (Hind site is red)
And this my pcr reaction:
Pfu buffer 10X:          5 ul
dNTPs 10mM:              1 ul
Sample:                  2 ul
Pfu polymerase:          0.5 ul
Primer mix 12.5 mM:      2 ul
DEPC:                    39.5 ul
Total:                   50 ul
Thermo cycle: 95oC 5', (95oC 1', 61oC 45s, 72oC 2') x 35 cycles, 72oC 5', 4oC forever
( I think that my PCR reaction for amplifying L1 gene is OK because I did not see any smear or contaminant band and my PCR product have corect size after purification and cutting -1.6 kb). I plan to clone this gene to pET28 vector (Novagen) but previous members in my lab have done it many times but they didnt succeed and i doubt that my gene cant' be cut by 2 enzymes, that's why i try to clone this gene into pBluescript vector to confirm my L1 gene can be cut by NheI and HindIII.
About E. coli strain, can you suggest any compatible strain (or plasmid vector) for cloning long DNA fragment for me ?? In my lab, we use 3 kinds of E.coli strains for cloning: DH5a, BL21(DE3), rossetta and usually use pET28 vector. We have succeeded in cloning some gene by this cloning system but only for short gene not for long gene as L1 and this project has lasted 3 years before i come to my lab. Pleas give me some ideas about this case, thank you very much !

Edited by Awnman, 19 February 2013 - 08:28 PM.


#5 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,803 posts
130
Excellent

Posted 20 February 2013 - 06:11 AM

What evidence do you have that the 1.6 kb PCR fragment does not have either a HindIII or NheI site internal to the gene? Have you cut the PCR fragment and then run the result on a gel?

#6 neuron

neuron

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 143 posts
3
Neutral

Posted 20 February 2013 - 07:59 PM

Both pBS and pET vectors were used in my earlier lab for long genes and E.coli strain DH5 alpha also used to work fine for use. I don't see any problem in vectors or strain. Some problem could be there in insert only. Did you get your PCR product sequenced? May be you should try cutting your insert with both the enzymes and see what you get as phage mentioned.





Also tagged with one or more of these keywords: cloning

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.