Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!


  • Please log in to reply
1 reply to this topic

#1 Komaltillu



  • Members
  • Pip
  • 1 posts

Posted 16 February 2013 - 10:18 PM

Hi I was trying to amplify a 5kb fragment from genomic DNA using Phusion high fidelity PCR but I never got any success. my forward primer is CCCACGAAACTCAAAATGTGTTCAGATTGC and my reverse primer is CACGAGCCAAAGTCATGCCAAAGAC. When I calculated the tm using the Tm calculator from Finnzymes it showed me around 72 C for both. I did a 2 step PCR with 72C but was unsuccessful. Each time I get a very low molecular band of around 200bp. I extracted the DNA and again ran the PCR but it was a failure again. I did a gradient with tm 55 to 65 which gave the same result. I used new dNTPs and borrowed enzyme from a collegue and saw that I had the same result. All my parameters look fine like primer concentration etc. Any suggestions? Please HELP.

#2 bob1


    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,907 posts

Posted 16 February 2013 - 11:39 PM

BLAST your primers against the genomic DNA and see what you get.

Your primers are big - standard PCR primers are 18-22 bp long. If you have added sites so that you can clone off the product - these bases should not be included in the Tm calculation.

Have you played with the Mg2+ concentration?

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.