Hi I was trying to amplify a 5kb fragment from genomic DNA using Phusion high fidelity PCR but I never got any success. my forward primer is CCCACGAAACTCAAAATGTGTTCAGATTGC and my reverse primer is CACGAGCCAAAGTCATGCCAAAGAC. When I calculated the tm using the Tm calculator from Finnzymes it showed me around 72 C for both. I did a 2 step PCR with 72C but was unsuccessful. Each time I get a very low molecular band of around 200bp. I extracted the DNA and again ran the PCR but it was a failure again. I did a gradient with tm 55 to 65 which gave the same result. I used new dNTPs and borrowed enzyme from a collegue and saw that I had the same result. All my parameters look fine like primer concentration etc. Any suggestions? Please HELP.
Submit your paper to J Biol Methods today!
PCR HELP!!!!
Started by Komaltillu, Feb 16 2013 10:18 PM
1 reply to this topic
#2
bob1
-
- Global Moderators
-
- 6,246 posts
Thelymitra pulchella
486
Excellent
Excellent
Posted 16 February 2013 - 11:39 PM
BLAST your primers against the genomic DNA and see what you get.
Your primers are big - standard PCR primers are 18-22 bp long. If you have added sites so that you can clone off the product - these bases should not be included in the Tm calculation.
Have you played with the Mg2+ concentration?
Your primers are big - standard PCR primers are 18-22 bp long. If you have added sites so that you can clone off the product - these bases should not be included in the Tm calculation.
Have you played with the Mg2+ concentration?
