Hi
I have been trying to clone a pcr product of 3065bp in pEF6V5 His TOPO vector. I have tried everything but couldnt amplify my product with normal taq. I have tried phusion (neb), recombinant taq (fermentas, sigma, invitrogen, intron biotech), dreamtaq (fermentas), platinum taq (invitrogen) and also Ex taq from takara but in vain as none gave any result. Thought phusion (neb) gives band of same size as required but it can not be cloned in TOPO due to 3'A missing.
based on many TOPO related forums i tried to standardize ploy A addition after amplifying my product with phusion (neb) but in vain!
What i am looking for is some taq polymerase or some way by which i can amplify my pcr product with any normal taq.
My primers are Fwd: 5’ ACATGCTTTGGGACTGCCACTGA 3’
Rev: 5’ GCCGGCAATGGACGTGAACA 3’
I am using 1x buffer, 2.5mM mgcl2, 1.25ul (0.5 uM) primers, 0.25mM dntp, 1U/ul Taq, 1ul (<500ng) template (cDNA) for a 25ul reaction.
The pcr conditions are
94 - 4 mins
94 - 45 secs
X - 30
72 - Y mins
72 - 10 mins
4 - hold
I have tried gradient of X from 55 to 68 but no result. And Y from 2 to 4 minutes but no result.
Pls suggest.
Thanks
Mansi
Stuck from last august! need help urgently - cloning and pcr !
Started by mansi368, Feb 05 2013 05:07 AM
7 replies to this topic
#1
Posted 05 February 2013 - 05:07 AM
#2
Posted 05 February 2013 - 07:39 AM
The standard approach to this problem is to amplfiy with Phusion, purify the DNA, then "A-tail" the DNA in a separate reaction using Taq. Sometimes this is done with dATP only instead of dNTP in the reaction. But there are many other approaches -- you are not forced to use TA cloning. TOPO blunt kits, for example, would directly clone your Phusion product. You could add addtional bases 5' to your primers to introduce restriction sites and clone using conventional restriction enzyme cloning.
#3
Posted 05 February 2013 - 08:14 PM
Thanks for your reply phage 434!
I have tried adding 3'A overhang but this doesnt work for me.. I am planning to add restriction sites at 5' end of my primer. There is a unique BstXI site in my vector. Is it okay if i use this topo vector for restriction based cloning instead of TA cloning.. i am worried if topoisomerase wud interfere with the latter type!
kindly clarify
thanks
I have tried adding 3'A overhang but this doesnt work for me.. I am planning to add restriction sites at 5' end of my primer. There is a unique BstXI site in my vector. Is it okay if i use this topo vector for restriction based cloning instead of TA cloning.. i am worried if topoisomerase wud interfere with the latter type!
kindly clarify
thanks
#4
Posted 06 February 2013 - 12:44 AM
The topo vector may not have a multiple cloning site (usually called MCS in the data-sheet). You could always find the non-topoTA equivalent vector if necessary.
#5
Posted 06 February 2013 - 02:33 AM
I am a fan of high fidelity invitrogen taq and it will give you 3'A overhang.
Have you try adding 5% DMSO ? I usually add 1.25 uL of DMSO into 25 uL of PCR reaction.
This will help to stablize DNA template.
also "1ul (<500ng) template" might be too much to start with ?
I would do a ten fold less DNA template or even 1/100 dilution.
hope this have helped
Have you try adding 5% DMSO ? I usually add 1.25 uL of DMSO into 25 uL of PCR reaction.
This will help to stablize DNA template.
also "1ul (<500ng) template" might be too much to start with ?
I would do a ten fold less DNA template or even 1/100 dilution.
hope this have helped
#6
Posted 06 February 2013 - 06:18 AM
The TOPO vector in the kit is precut and linked to the TOPO protein. It is not suitable for restriction cloning. However, you likely have a great many colonies of the wrong thing, from which a miniprep would yield a plasmid which could be used. I would choose a different vector, however. A basic one such as pUC19 might work well.
I strongly agree with Lisa that you should dilute your template DNA. You might also try adding 3-8% betaine 1M solution (Qiagen "Q-solution") instead of the DMSO.
Is your template high GC?
I strongly agree with Lisa that you should dilute your template DNA. You might also try adding 3-8% betaine 1M solution (Qiagen "Q-solution") instead of the DMSO.
Is your template high GC?
#7
Posted 06 February 2013 - 08:06 AM
Yes, my template is GC rich and i have used DMSO (5%) but no band. pls look on this link http://products.invi...product/K961020 as u can see there is a unqiue BstXI site flanking the TOPO cloning site, i want to know if i can use this site for restriction based cloning in this vector?
#8
Posted 06 February 2013 - 11:33 AM
Actually it isn't unique - there are two of them... Potentially you could use these to cut the topo and short flanking sequence off each side then ligate the ends together to form a circular plasmid - however, it will be easier and quicker to follow Phage's suggestion of just picking a no insert colony and growing that up













