I have a clone with promoter followed by 96 tandem array of binding sites for a protein but I need to construct one more clone with 48 tandem array of binding sites from same clone. I need a strategy to do this.
Please help me in this
I have a 96 tandem array repeat clone but need half of them in new clone
Started by nvramakanth, Jan 22 2013 08:33 AM
4 replies to this topic
#1
Posted 22 January 2013 - 08:33 AM
#2
Posted 22 January 2013 - 11:31 AM
Two ways-
1) find a cut site in the array that will cut it in half more or less, blunt the cut site and do something similar for the other end of the plasmid.
2) PCR the array off the plasmid using primers with unique cutting site incorporated.
1) find a cut site in the array that will cut it in half more or less, blunt the cut site and do something similar for the other end of the plasmid.
2) PCR the array off the plasmid using primers with unique cutting site incorporated.
#3
Posted 22 January 2013 - 11:51 AM
If all you have is an existing multiple repeat sequence, it might be difficult. You can clone a single sequence (perhaps made with annealed oligos) multiple times, doubling the number of repeats each time. You need pairs of restriction sites at each end with the inner ones isoschizimers (look at the biobrick cloning site for an example). PCR will be very difficult with highly repetitive sequences.
#4
Posted 04 February 2013 - 05:24 AM
Hi
Thanks for the reply...The 96binding site tandem is developed by biobrick cloning and it took long time for us..Thanks however
Thelymitra...can you please elaborate it to more extent
My Plasmid sequence is RFP1-96 BS(ACATGAGGATCACCCATGTGT)96 times....can you please explain furhter so that i could design primers...Thanks
Thanks for the reply...The 96binding site tandem is developed by biobrick cloning and it took long time for us..Thanks however
Thelymitra...can you please elaborate it to more extent
My Plasmid sequence is RFP1-96 BS(ACATGAGGATCACCCATGTGT)96 times....can you please explain furhter so that i could design primers...Thanks
#5
Posted 04 February 2013 - 06:23 AM
That's the problem, you can't design primers, since all sites are the same. If you made this using biobricks, then there must have been intermediates which were half-length that were made as part of the construction.













