Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

I have a 96 tandem array repeat clone but need half of them in new clone


  • Please log in to reply
4 replies to this topic

#1 nvramakanth

nvramakanth

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 22 January 2013 - 08:33 AM

I have a clone with promoter followed by 96 tandem array of binding sites for a protein but I need to construct one more clone with 48 tandem array of binding sites from same clone. I need a strategy to do this.

Please help me in this

#2 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,618 posts
387
Excellent

Posted 22 January 2013 - 11:31 AM

Two ways-
1) find a cut site in the array that will cut it in half more or less, blunt the cut site and do something similar for the other end of the plasmid.
2) PCR the array off the plasmid using primers with unique cutting site incorporated.

#3 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,417 posts
237
Excellent

Posted 22 January 2013 - 11:51 AM

If all you have is an existing multiple repeat sequence, it might be difficult. You can clone a single sequence (perhaps made with annealed oligos) multiple times, doubling the number of repeats each time. You need pairs of restriction sites at each end with the inner ones isoschizimers (look at the biobrick cloning site for an example). PCR will be very difficult with highly repetitive sequences.

#4 nvramakanth

nvramakanth

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 04 February 2013 - 05:24 AM

Hi

Thanks for the reply...The 96binding site tandem is developed by biobrick cloning and it took long time for us..Thanks however

Thelymitra...can you please elaborate it to more extent

My Plasmid sequence is RFP1-96 BS(ACATGAGGATCACCCATGTGT)96 times....can you please explain furhter so that i could design primers...Thanks

#5 phage434

phage434

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 2,417 posts
237
Excellent

Posted 04 February 2013 - 06:23 AM

That's the problem, you can't design primers, since all sites are the same. If you made this using biobricks, then there must have been intermediates which were half-length that were made as part of the construction.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.