Warning: mb_substr_count() expects at most 3 parameters, 4 given in /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php on line 1269

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 110

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 127

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 136

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 137

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 141
unexpected band in PCR with plasmid - PCR, RT-PCR and Real-Time PCR - BioForum

Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

unexpected band in PCR with plasmid

  • Please log in to reply
4 replies to this topic

#1 Indhu



  • Members
  • Pip
  • 4 posts

Posted 10 January 2013 - 04:24 AM

i have designed a set of primers for checking cloning in the plasmid pET28b. Though the primers are not expected to bring out any band with empty plasmid, it shows a band around 100bp which is also observed in the transformant plasmid. the primer sequences are:PET F- ATTCGGATCCACTAGTTATTG PET R- AATTCCCCTCTAGACCCTTGA. can anyone pls refer any online tool to get the sequence of the amplicons on submitting the template and primers.

#2 leelee



  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 652 posts

Posted 10 January 2013 - 04:54 AM

It is most likely just primer dimer, could you post a gel photo?

#3 doxorubicin



  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 193 posts

Posted 10 January 2013 - 06:34 AM

Your primers both have fairly long strings of homology with the pET28b sequence. If you compare the pET28b sequence with the forward primer sequence using clustal you will see perfect base paring of 10 bases. Similarly if you compare the pET28b sequence to the reverse complement of the reverse primer you see perfect base paring of 14 bases.

Then if you do a primer blast (http://www.ncbi.nlm....s/primer-blast/) using just the perfect base paring parts of the primers, you get a product of 154bps.

Primer pair 1
Forward primer ATTCGGATCC
Product length 154

#4 Indhu



  • Members
  • Pip
  • 4 posts

Posted 11 January 2013 - 01:07 AM

Actually the primers were designed earlier by my labmate, and while checking i saw the complementarity of the forward primer with the plasmid. But i couldn see the complementarity of the reverse primer, so only i proceeded with the PCR.

#5 doxorubicin



  • Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 193 posts

Posted 11 January 2013 - 05:06 AM

The secret to finding your reverse primer in your sequence: http://www.bioinform...s/rev_comp.html

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.