Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

identification of target sequence


  • Please log in to reply
3 replies to this topic

#1 helpwithdna

helpwithdna

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 16 December 2012 - 04:14 PM

Dear all,
i have just done an experiment on extraction of our own cheek cells DNA and it was primed by the sequence. How can I identify the target DNA sequence that these primers (please find the attach) are priming from the online genbank database?

Thanks!

Attached Thumbnails

  • 未命名.png

Edited by helpwithdna, 16 December 2012 - 04:15 PM.


#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
68
Excellent

Posted 16 December 2012 - 10:07 PM

You can use in silico PCR tool to find the target.

Your primers amplify the following DNA which is the insulin gene

>chr11:2181001-2182447 1447bp
GCGCTAGCAGCCCTCCAGGACAGG
GCGGTACCGCTGGTTCAAGGGCTTTATTCC
caGCcctCAGCCCTCCAGGACAGGctgcatcagaagaggccatcaagcag
gtctgttccaagggcctttgcgtcaggtgggctcaggattccagggtggc
tggaccccaggccccagctctgcagcagggaggacgtggctgggctcgtg
aagcatgtgggggtgagcccaggggccccaaggcagggcacctggccttc
agcctgcctcagccctgcctgtctcccagatcactgtccttctgccatgg
ccctgtggatgcgcctcctgcccctgctggcgctgctggccctctgggga
cctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacct
ggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacac
ccaagacccgccgggaggcagaggacctgcagggtgagccaactgcccat
tgctgcccctggccgcccccagccaccccctgctcctggcgctcccaccc
agcatgggcagaagggggcaggaggctgccacccagcagggggtcaggtg
cacttttttaaaaagaagttctcttggtcacgtcctaaaagtgaccagct
ccctgtggcccagtcagaatctcagcctgaggacggtgttggcttcggca
gccccgagatacatcagagggtgggcacgctcctccctccactcgcccct
caaacaaatgccccgcagcccatttctccaccctcatttgatgaccgcag
attcaagtgttttgttaagtaaagtcctgggtgacctggggtcacagggt
gccccacgctgcctgcctctgggcgaacaccccatcacgcccggaggagg
gcgtggctgcctgcctgagtgggccagacccctgtcgccaggcctcacgg
cagctccatagtcaggagatggggaagatgctggggacaggccctgggga
gaagtactgggatcacctgttcaggctcccactgtgacgctgccccgggg
cgggggaaggaggtgggacatgtgggcgttggggcctgtaggtccacacc
cagtgtgggtgaccctccctctaacctgggtccagcccggctggagatgg
gtgggagtgcgacctagggctggcgggcaggcgggcactgtgtctccctg
actgtgtcctcctgtgtccctctgcctcgccgctgttccggaacctgctc
tgcgcggcacgtcctggcagtggggcaggtggagctgggcgggggccctg
gtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgt
ggcattgtggaacaatgctgtaccagcatctgctccctctaccagctgga
gaactactgcaactagacgcagcccgcaggcagccccacacccgccgcct
cctgcaccgagagagatGGAATAAAGCCCTTGAACCAGCccTgCtGt

Genome browser view http://genome.ucsc.e...gPcrResult=pack

#3 helpwithdna

helpwithdna

    member

  • Active Members
  • Pip
  • 14 posts
0
Neutral

Posted 17 December 2012 - 05:02 AM

You can use in silico PCR tool to find the target.

Your primers amplify the following DNA which is the insulin gene


>chr11:2181001-2182447 1447bp
GCGCTAGCAGCCCTCCAGGACAGG
GCGGTACCGCTGGTTCAAGGGCTTTATTCC
caGCcctCAGCCCTCCAGGACAGGctgcatcagaagaggccatcaagcag
gtctgttccaagggcctttgcgtcaggtgggctcaggattccagggtggc
tggaccccaggccccagctctgcagcagggaggacgtggctgggctcgtg
aagcatgtgggggtgagcccaggggccccaaggcagggcacctggccttc
agcctgcctcagccctgcctgtctcccagatcactgtccttctgccatgg
ccctgtggatgcgcctcctgcccctgctggcgctgctggccctctgggga
cctgacccagccgcagcctttgtgaaccaacacctgtgcggctcacacct
ggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacac
ccaagacccgccgggaggcagaggacctgcagggtgagccaactgcccat
tgctgcccctggccgcccccagccaccccctgctcctggcgctcccaccc
agcatgggcagaagggggcaggaggctgccacccagcagggggtcaggtg
cacttttttaaaaagaagttctcttggtcacgtcctaaaagtgaccagct
ccctgtggcccagtcagaatctcagcctgaggacggtgttggcttcggca
gccccgagatacatcagagggtgggcacgctcctccctccactcgcccct
caaacaaatgccccgcagcccatttctccaccctcatttgatgaccgcag
attcaagtgttttgttaagtaaagtcctgggtgacctggggtcacagggt
gccccacgctgcctgcctctgggcgaacaccccatcacgcccggaggagg
gcgtggctgcctgcctgagtgggccagacccctgtcgccaggcctcacgg
cagctccatagtcaggagatggggaagatgctggggacaggccctgggga
gaagtactgggatcacctgttcaggctcccactgtgacgctgccccgggg
cgggggaaggaggtgggacatgtgggcgttggggcctgtaggtccacacc
cagtgtgggtgaccctccctctaacctgggtccagcccggctggagatgg
gtgggagtgcgacctagggctggcgggcaggcgggcactgtgtctccctg
actgtgtcctcctgtgtccctctgcctcgccgctgttccggaacctgctc
tgcgcggcacgtcctggcagtggggcaggtggagctgggcgggggccctg
gtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgt
ggcattgtggaacaatgctgtaccagcatctgctccctctaccagctgga
gaactactgcaactagacgcagcccgcaggcagccccacacccgccgcct
cctgcaccgagagagatGGAATAAAGCCCTTGAACCAGCccTgCtGt

Genome browser view http://genome.ucsc.e...gPcrResult=pack


Thanks for your help! I got another problem. The bands from recombinant plasmid are not visible from gel electrophoresis. The marker gene is able to show its bands. Is it the invisible band most probably due to contamination of the samples? Should I load the samples and run another gel again?Thanks!

Edited by helpwithdna, 17 December 2012 - 05:03 AM.


#4 bob1

bob1

    Thelymitra pulchella

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 5,828 posts
413
Excellent

Posted 17 December 2012 - 11:39 AM

So you can't see the plasmid on a DNA based gel, but the ladders are visible?

If so - how did you prepare the plasmid DNA and how much DNA did you run on the gel?




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.