Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

any experience in cloning a 3.5kb full length cDNA


  • Please log in to reply
4 replies to this topic

#1 Helen J

Helen J

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 17 December 2003 - 10:05 PM

:D

I am trying to clone a full-length cDNA which is about 3.5kb and has a GC contents of 65%. My primers are as follows:

Sense Primer:
     CGCGGATCCCCACC ATGCCGGTGCGGAGGGGCCACGTCG
      Length: 39  Tm: 74.1 C  GC: 76.9
      
Antisense Primer:
     TGCTCTAGA TGAGCCACGTGTCCACACTGGGCAGC
      Length: 35  Tm: 76.8 C  GC: 60.0


I used a human brain cDNA library and a Marathon-Ready cDNA from Clontech. I can get the b-actin PCR product with both of them. But could not get the full-length cDNA I want. I have tried the platinum pfx from invitrogen but failed too. I wonder what is wrong. Do you have any suggestions? Does DMSO or formaldehyde help in such PCR?

Thanks a lot

#2 labrat

labrat

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 62 posts
0
Neutral

Posted 17 December 2003 - 10:17 PM

I can only think of two things:

You may try two-step cycling.

The copy number of your gene may be very low in the library. Try some other libraries prepared from tissue which is known to express your gene high.

Hope it helps.

#3 Helen J

Helen J

    member

  • Members
  • Pip
  • 2 posts
0
Neutral

Posted 18 December 2003 - 01:17 AM

Thank you, labrat.
If I have a cell line that highly express the gene I want, may I use RT-PCR method to clone the full-length cDNA of it? Does the mRNA degrade easily?

#4 labrat

labrat

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 62 posts
0
Neutral

Posted 18 December 2003 - 09:43 AM

Helen J, on Dec 18 2003, 01:17 AM, said:

If I have a cell line that highly express the gene I want, may I use RT-PCR method to clone the full-length cDNA of it? Does the mRNA degrade easily?
Yes, you can. Do a RT with longer extension. In this situation, I will prefer using random primer than oligo dT, because extension from poly A tail 3000 bp upstream may be problematic sometimes. Random primer will give you more confidence.

Following basic principles of handling RNA, RNA degradation should not be a concern. After extraction, run a gel to check the quality of your newly isolated RNA, you should see clearly 28S and 18S band without smear. After RT, also run a gel to see what's the average size of newly synthesized cDNA.

#5 jonnyr9

jonnyr9

    member

  • Members
  • Pip
  • 5 posts
0
Neutral

Posted 07 January 2004 - 02:01 AM

I have read the adding 1.3M betaine may help amplify high-GC content targets.

See: Wayne Barnes - http://biochem.wustl...barnes/faq.wpa/

I have had more success amplifying from freshly reverse transcribed RNA from target tissue than cDNA libraries.  I would try a whole series of annealing temperatures, trying an extension time of several minutes (5-10) to ensure you don't enrich for shorter incomplete sequences.

Also - does the entire primer anneal or just a section?  Those primers seem a little long, making very high melting temperature and annealing temperatures.  Lastly, there's always touchdown PCR.




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.