Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

T7 promoter ending; to add or not to add GGG

promoter sequence

  • Please log in to reply
2 replies to this topic

#1 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,113 posts
59
Excellent

Posted 04 December 2012 - 10:36 PM

Hi,

The sequence of T7 promoter in most plasmids is TAATACGACTCACTATAGGG, and all T7 universal forward primers end with GGG. I believe the promoter itself ends with TATA. So addition of GGG is for better transcription.

Now, I am working on a virus that only assembles itself if it follows the rule of 6, meaning the genome size must be either 15186, 15192 or 15198 bases. I need to add a T7 promoter right before the genome start, and clone this into a transcription vector. What I have noticed is that some articles don't have the GGG after TATA. Others only have 2 Gs instead of 3 Gs and this is confusing.

I think I'm just gonna omit GGG. Since my genome starts with ACC..., and T7 polymerase initiates right after TATA, then presence of an A instead of G should not be a major problem. This way I won't disturb the rule of 6 with addition of GGG.

Do you agree?

#2 Inbox

Inbox

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 331 posts
21
Excellent

Posted 10 December 2012 - 11:07 AM

May be you need to consider adding GGGAGA (highest product yields if the first 6 nucs are GGGAGA) after TATA.

see
http://www.protocol-...osts/25892.html

P.S.- just interpreting based on link in forum, refer to more literature.

#3 Curtis

Curtis

    Metaller Scientist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,113 posts
59
Excellent

Posted 10 December 2012 - 05:15 PM

good point, thanks





Also tagged with one or more of these keywords: promoter sequence

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.